Transcript: Human NM_001317095.2

Homo sapiens N(alpha)-acetyltransferase 60, NatF catalytic subunit (NAA60), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
NAA60 (79903)
Length:
2471
CDS:
223..756

Additional Resources:

NCBI RefSeq record:
NM_001317095.2
NBCI Gene record:
NAA60 (79903)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317095.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114645 AGACTCATGGTATCGTGATAT pLKO.1 144 5UTR 100% 13.200 18.480 N Naa60 n/a
2 TRCN0000317646 AGACTCATGGTATCGTGATAT pLKO_005 144 5UTR 100% 13.200 18.480 N Naa60 n/a
3 TRCN0000430575 ATGGACACACTTGACCGTAAA pLKO_005 1202 3UTR 100% 10.800 15.120 N NAA60 n/a
4 TRCN0000162306 CAGACTCATGGTATCGTGATA pLKO.1 143 5UTR 100% 4.950 6.930 N NAA60 n/a
5 TRCN0000163819 CCAGACTCATGGTATCGTGAT pLKO.1 142 5UTR 100% 4.050 5.670 N NAA60 n/a
6 TRCN0000162778 CGTCGTGAAAGAGTTCAGGAA pLKO.1 333 CDS 100% 2.640 3.696 N NAA60 n/a
7 TRCN0000429949 CCACCAACAACACAGCAATAA pLKO_005 449 CDS 100% 13.200 9.240 N NAA60 n/a
8 TRCN0000350019 GGGAATGATAGTAGCTGAAAT pLKO_005 219 5UTR 100% 13.200 9.240 N Naa60 n/a
9 TRCN0000425678 GTGCCATTGTGGGAATGATAG pLKO_005 209 5UTR 100% 10.800 7.560 N NAA60 n/a
10 TRCN0000158889 GAAATTAAGAACAGGACCAAA pLKO.1 235 CDS 100% 4.950 3.465 N NAA60 n/a
11 TRCN0000164060 CCTCAAAGATGGCTTCACCTA pLKO.1 537 CDS 100% 2.640 1.848 N NAA60 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317095.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08982 pDONR223 100% 73% 73.1% None 0_1ins195;357C>G n/a
2 ccsbBroad304_08982 pLX_304 0% 73% 73.1% V5 (not translated due to prior stop codon) 0_1ins195;357C>G n/a
3 TRCN0000473974 TACGTAGTTCTACTATCGCCCGTT pLX_317 80.5% 73% 73.1% V5 (not translated due to prior stop codon) 0_1ins195;357C>G n/a
Download CSV