Transcript: Human NM_001317338.2

Homo sapiens mitochondrial amidoxime reducing component 2 (MTARC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
MTARC2 (54996)
Length:
2153
CDS:
211..1218

Additional Resources:

NCBI RefSeq record:
NM_001317338.2
NBCI Gene record:
MTARC2 (54996)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317338.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229938 ATGGATCCACTAGGGTGATAT pLKO_005 1228 3UTR 100% 13.200 18.480 N MTARC2 n/a
2 TRCN0000229937 ACCTGGGATGAACTCCTAATT pLKO_005 964 CDS 100% 13.200 10.560 N MTARC2 n/a
3 TRCN0000165889 GCTCCAGGTTAATGCAAGGAA pLKO.1 1394 3UTR 100% 3.000 2.400 N MTARC2 n/a
4 TRCN0000166008 GCAGCAACGATACATCAGCAA pLKO.1 1298 3UTR 100% 2.640 2.112 N MTARC2 n/a
5 TRCN0000229935 ATATTTGGCCTTGACATTAAA pLKO_005 658 CDS 100% 15.000 10.500 N MTARC2 n/a
6 TRCN0000229936 GGAGAATTTCAGGCCAAATAT pLKO_005 909 CDS 100% 15.000 10.500 N MTARC2 n/a
7 TRCN0000218697 GTGCTCATCTCCATCATTTAT pLKO_005 544 CDS 100% 15.000 10.500 N MTARC2 n/a
8 TRCN0000160727 CAGGATATTTGGCCTTGACAT pLKO.1 654 CDS 100% 4.950 3.465 N MTARC2 n/a
9 TRCN0000158506 CATCTCCATCATTTATGAGAA pLKO.1 549 CDS 100% 4.950 3.465 N MTARC2 n/a
10 TRCN0000162042 CCTCAAACAAACTCCACAACT pLKO.1 632 CDS 100% 4.950 3.465 N MTARC2 n/a
11 TRCN0000160599 CGATACATCAGCAAATCCTTA pLKO.1 1305 3UTR 100% 4.950 3.465 N MTARC2 n/a
12 TRCN0000159643 GATTGGTTCAATTTGAGACAA pLKO.1 743 CDS 100% 4.950 3.465 N MTARC2 n/a
13 TRCN0000159783 GAACTCCTAATTGGTAGTGTA pLKO.1 973 CDS 100% 4.950 2.970 N MTARC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317338.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08446 pDONR223 100% 99.7% 99.7% None 72G>C;132G>T;528G>A n/a
2 ccsbBroad304_08446 pLX_304 0% 99.7% 99.7% V5 72G>C;132G>T;528G>A n/a
3 TRCN0000480886 GCCAGCTCACAAAAGCGTAGCCCG pLX_317 50.9% 99.7% 99.7% V5 72G>C;132G>T;528G>A n/a
Download CSV