Transcript: Human NM_001317406.2

Homo sapiens solute carrier family 6 member 11 (SLC6A11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SLC6A11 (6538)
Length:
11069
CDS:
39..665

Additional Resources:

NCBI RefSeq record:
NM_001317406.2
NBCI Gene record:
SLC6A11 (6538)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416773 GAGGAAAGTTTGCCCTTTATT pLKO_005 404 CDS 100% 15.000 10.500 N SLC6A11 n/a
2 TRCN0000427917 TGGAGTTCCAGAAACTGAATG pLKO_005 580 CDS 100% 10.800 7.560 N SLC6A11 n/a
3 TRCN0000042894 CCATCTGAATGTGTACTACAT pLKO.1 461 CDS 100% 4.950 3.465 N SLC6A11 n/a
4 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 2190 3UTR 100% 4.950 2.475 Y CENPL n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 10588 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2265 3UTR 100% 4.950 2.475 Y LOC339059 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 10588 3UTR 100% 5.625 2.813 Y EID2B n/a
8 TRCN0000417475 TTCCTGGCTTCTGTGAGCACC pLKO_005 775 3UTR 100% 0.720 0.360 Y HBA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11136 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11136 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473624 ATTCTTAGGCATGTTGATGCACAT pLX_317 22.1% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV