Transcript: Human NM_001317744.2

Homo sapiens WRB-SH3BGR readthrough (WRB-SH3BGR), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
WRB-SH3BGR (106865373)
Length:
1332
CDS:
60..881

Additional Resources:

NCBI RefSeq record:
NM_001317744.2
NBCI Gene record:
WRB-SH3BGR (106865373)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421554 CCAGGGTTACTGAGGACTTAT pLKO_005 999 3UTR 100% 13.200 6.600 Y SH3BGR n/a
2 TRCN0000433987 GGAAGCTATGAAGCAACATTT pLKO_005 921 3UTR 100% 13.200 6.600 Y SH3BGR n/a
3 TRCN0000424970 TAAATGTGAAGACCGTTTATG pLKO_005 1073 3UTR 100% 13.200 6.600 Y SH3BGR n/a
4 TRCN0000413539 GAGGTATCTCCCGAATCATAC pLKO_005 1047 3UTR 100% 10.800 5.400 Y SH3BGR n/a
5 TRCN0000134601 GTGTTTGGATGCAATGTTCTT pLKO.1 111 CDS 100% 4.950 2.475 Y GET1 n/a
6 TRCN0000312510 GTGTTTGGATGCAATGTTCTT pLKO_005 111 CDS 100% 4.950 2.475 Y GET1 n/a
7 TRCN0000127972 GAAGAAACTGCAGAAGGAGAA pLKO.1 834 CDS 100% 4.050 2.025 Y SH3BGR n/a
8 TRCN0000129450 GAGGAGGAAGAAACTGCAGAA pLKO.1 828 CDS 100% 4.050 2.025 Y SH3BGR n/a
9 TRCN0000127810 GATCTTCAATGAGGAGCAGTA pLKO.1 554 CDS 100% 4.050 2.025 Y SH3BGR n/a
10 TRCN0000129613 CTGGAGATGAAGACAACAGGA pLKO.1 469 CDS 100% 2.640 1.320 Y SH3BGR n/a
11 TRCN0000129510 GAGAGAGAATGTTCCTGGAGA pLKO.1 497 CDS 100% 2.640 1.320 Y SH3BGR n/a
12 TRCN0000136457 CAATGTTCTTAGGATCCTCCT pLKO.1 122 CDS 100% 2.160 1.080 Y GET1 n/a
13 TRCN0000312563 CAATGTTCTTAGGATCCTCCT pLKO_005 122 CDS 100% 2.160 1.080 Y GET1 n/a
14 TRCN0000131048 CCAGATCTTCAATGAGGAGCA pLKO.1 551 CDS 100% 2.160 1.080 Y SH3BGR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06944 pDONR223 100% 72.8% 58.9% None (many diffs) n/a
2 ccsbBroad304_06944 pLX_304 0% 72.8% 58.9% V5 (many diffs) n/a
Download CSV