Transcript: Human NM_001317836.2

Homo sapiens polycomb group ring finger 3 (PCGF3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PCGF3 (10336)
Length:
6057
CDS:
428..1156

Additional Resources:

NCBI RefSeq record:
NM_001317836.2
NBCI Gene record:
PCGF3 (10336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230160 TTCCCATCGGAATGGTGAAAC pLKO_005 787 CDS 100% 10.800 15.120 N PCGF3 n/a
2 TRCN0000034262 GCACTTAGATTCCCATCGGAA pLKO.1 778 CDS 100% 2.640 3.696 N PCGF3 n/a
3 TRCN0000034261 GCAGACGACAGTTCAAACAAA pLKO.1 812 CDS 100% 5.625 4.500 N PCGF3 n/a
4 TRCN0000230159 AGAGGGAGTTCTATCACAAAT pLKO_005 705 CDS 100% 13.200 9.240 N PCGF3 n/a
5 TRCN0000034260 GCAGAGGGAGTTCTATCACAA pLKO.1 703 CDS 100% 4.950 3.465 N PCGF3 n/a
6 TRCN0000095494 CCAGCTTTATTTACAGGCATA pLKO.1 3847 3UTR 100% 4.050 2.835 N Pcgf3 n/a
7 TRCN0000034259 CTGAAGAAGTTCATCGCCAAA pLKO.1 980 CDS 100% 4.050 2.835 N PCGF3 n/a
8 TRCN0000230162 ACTCAACCTTTCATCCTTTAA pLKO_005 1003 CDS 100% 13.200 7.920 N PCGF3 n/a
9 TRCN0000230161 AGCATCTGCCTGGAGTGTAAC pLKO_005 893 CDS 100% 10.800 6.480 N PCGF3 n/a
10 TRCN0000034263 GCTGCACTACAGACCCAAGAT pLKO.1 1123 CDS 100% 4.950 2.970 N PCGF3 n/a
11 TRCN0000218518 GTTTAGTGCACATAGCTAAAT pLKO_005 4477 3UTR 100% 1.320 0.660 Y PCGF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14044 pDONR223 100% 99.8% 78.1% None 570_571insA n/a
2 ccsbBroad304_14044 pLX_304 0% 99.8% 78.1% V5 (not translated due to prior stop codon) 570_571insA n/a
3 TRCN0000470031 TCACGCTCTAAATTTCTGACACAG pLX_317 58.5% 99.8% 78.1% V5 (not translated due to prior stop codon) 570_571insA n/a
Download CSV