Transcript: Human NM_001317911.2

Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1L (PPM1L), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
PPM1L (151742)
Length:
10573
CDS:
127..828

Additional Resources:

NCBI RefSeq record:
NM_001317911.2
NBCI Gene record:
PPM1L (151742)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355917 GATTGCTCTGCTATCAGATAA pLKO_005 333 CDS 100% 13.200 18.480 N PPM1L n/a
2 TRCN0000002699 ACGTGTTTGATTGCTCTGCTA pLKO.1 325 CDS 100% 2.640 3.696 N PPM1L n/a
3 TRCN0000355916 CCTGGTGGTCTTAGGTCTATA pLKO_005 952 3UTR 100% 13.200 9.240 N PPM1L n/a
4 TRCN0000355852 TCTCAGCTGCCTTAGACTAAA pLKO_005 841 3UTR 100% 13.200 9.240 N PPM1L n/a
5 TRCN0000355853 ATCTTCAGGACTACGAGAAAG pLKO_005 194 CDS 100% 10.800 7.560 N PPM1L n/a
6 TRCN0000002698 AGGTGGTTTCATCAGTTTCAA pLKO.1 480 CDS 100% 5.625 3.938 N PPM1L n/a
7 TRCN0000002696 CCCATGAGATTTGCTTACTTT pLKO.1 2596 3UTR 100% 5.625 3.938 N PPM1L n/a
8 TRCN0000002700 CGTGTTTGATTGCTCTGCTAT pLKO.1 326 CDS 100% 4.950 3.465 N PPM1L n/a
9 TRCN0000080877 CCTATGATGAAGCAGGCACAA pLKO.1 305 CDS 100% 4.050 2.835 N Ppm1l n/a
10 TRCN0000002697 GTGACAAAGATGGGAACGCTA pLKO.1 398 CDS 100% 2.640 1.848 N PPM1L n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5489 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5489 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317911.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13279 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13279 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477392 ACAGGCCTATCCCGGCGGGGTGTA pLX_317 61.6% 100% 100% V5 n/a
Download CSV