Transcript: Human NM_001317998.1

Homo sapiens zinc finger protein 677 (ZNF677), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
ZNF677 (342926)
Length:
3740
CDS:
379..2133

Additional Resources:

NCBI RefSeq record:
NM_001317998.1
NBCI Gene record:
ZNF677 (342926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317998.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417311 TTATACCATCTGGTGATATTA pLKO_005 607 CDS 100% 15.000 21.000 N ZNF677 n/a
2 TRCN0000419001 TCAGGATACACCATTCATATT pLKO_005 2448 3UTR 100% 13.200 18.480 N ZNF677 n/a
3 TRCN0000020674 CCTGTGGGACTATGATGTAAA pLKO.1 702 CDS 100% 13.200 9.240 N ZNF677 n/a
4 TRCN0000020675 GCCTTTACTGAACGTTCAAAT pLKO.1 1861 CDS 100% 13.200 9.240 N ZNF677 n/a
5 TRCN0000020676 CCAGTATTTCATCCATGACAA pLKO.1 846 CDS 100% 4.950 3.465 N ZNF677 n/a
6 TRCN0000020678 GCTGGCTGAACTACAGAGATT pLKO.1 972 CDS 100% 4.950 3.465 N ZNF677 n/a
7 TRCN0000020677 CAAAGTTCAAACCTTGGAGAT pLKO.1 2038 CDS 100% 4.050 2.835 N ZNF677 n/a
8 TRCN0000430520 TCACTAGGCATCAGAATATAC pLKO_005 1631 CDS 100% 13.200 6.600 Y ZNF677 n/a
9 TRCN0000429043 ACCTTACAAATGTAATGAATG pLKO_005 1413 CDS 100% 10.800 5.400 Y Rex2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3156 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 2902 3UTR 100% 0.495 0.248 Y C11orf44 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3156 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317998.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05485 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05485 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478339 GGCATACGGCTCAGGAGGTCCGGT pLX_317 17.3% 100% 100% V5 n/a
Download CSV