Transcript: Human NM_001318000.1

Homo sapiens CWC27 spliceosome associated cyclophilin (CWC27), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
CWC27 (10283)
Length:
2975
CDS:
230..1231

Additional Resources:

NCBI RefSeq record:
NM_001318000.1
NBCI Gene record:
CWC27 (10283)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000136 CGAGCAGATGAACTTAACAAT pLKO.1 584 CDS 100% 5.625 3.938 N CWC27 n/a
2 TRCN0000338374 CGAGCAGATGAACTTAACAAT pLKO_005 584 CDS 100% 5.625 3.938 N CWC27 n/a
3 TRCN0000000138 GAACCTGATGAGAGAAAGAAT pLKO.1 1063 CDS 100% 5.625 3.938 N CWC27 n/a
4 TRCN0000338375 GAACCTGATGAGAGAAAGAAT pLKO_005 1063 CDS 100% 5.625 3.938 N CWC27 n/a
5 TRCN0000000137 AGACCACATAATCCACACAAA pLKO.1 689 CDS 100% 4.950 2.970 N CWC27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14042 pDONR223 100% 55.5% 2.9% None (many diffs) n/a
2 ccsbBroad304_14042 pLX_304 0% 55.5% 2.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475809 GGGATCCATAGTTAGTCTAAAATC pLX_317 38.7% 55.5% 2.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV