Transcript: Human NM_001318005.1

Homo sapiens zinc finger protein 514 (ZNF514), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
ZNF514 (84874)
Length:
6315
CDS:
603..2024

Additional Resources:

NCBI RefSeq record:
NM_001318005.1
NBCI Gene record:
ZNF514 (84874)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016832 CTCATACTGCATCCCTTATTA pLKO.1 1966 CDS 100% 15.000 21.000 N ZNF514 n/a
2 TRCN0000016831 CTGGGCCTTCTAGTATCCAAA pLKO.1 939 CDS 100% 4.950 3.960 N ZNF514 n/a
3 TRCN0000016830 GTCACACTTCATCCCTTATTA pLKO.1 1714 CDS 100% 15.000 10.500 N ZNF514 n/a
4 TRCN0000016829 TGGTCATATTTCATCCCTTAT pLKO.1 1544 CDS 100% 10.800 7.560 N ZNF514 n/a
5 TRCN0000016828 CCAAGGAATCAATGCCAAGTT pLKO.1 1060 CDS 100% 4.950 3.465 N ZNF514 n/a
6 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1669 CDS 100% 13.200 6.600 Y Zfp934 n/a
7 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1669 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
8 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1669 CDS 100% 13.200 6.600 Y EG668616 n/a
9 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1667 CDS 100% 4.950 2.475 Y ZNF254 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318005.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04438 pDONR223 100% 84.5% 84.5% None 1_219del n/a
Download CSV