Transcript: Human NM_001318031.2

Homo sapiens spalt like transcription factor 4 (SALL4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
SALL4 (57167)
Length:
3898
CDS:
114..1964

Additional Resources:

NCBI RefSeq record:
NM_001318031.2
NBCI Gene record:
SALL4 (57167)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419286 GAGTCTGTGGTGTACCTAAAG pLKO_005 561 CDS 100% 10.800 15.120 N SALL4 n/a
2 TRCN0000021874 CCGACCTATGTCAAGGTTGAA pLKO.1 1302 CDS 100% 4.950 6.930 N SALL4 n/a
3 TRCN0000021876 GCCTTGAAACAAGCCAAGCTA pLKO.1 975 CDS 100% 3.000 4.200 N SALL4 n/a
4 TRCN0000021878 GTGAGGATGAAGCCACAGTAA pLKO.1 283 CDS 100% 4.950 2.970 N SALL4 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2446 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 1476 CDS 100% 6.000 3.000 Y Zfp612 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2446 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08715 pDONR223 100% 58.4% 58.4% None (many diffs) n/a
2 ccsbBroad304_08715 pLX_304 0% 58.4% 58.4% V5 (many diffs) n/a
3 TRCN0000466631 CGGACCGACACGAGCACACATAAT pLX_317 12.4% 58.4% 58.4% V5 (many diffs) n/a
Download CSV