Transcript: Human NM_001318144.2

Homo sapiens aquaporin 3 (Gill blood group) (AQP3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
AQP3 (360)
Length:
1607
CDS:
64..777

Additional Resources:

NCBI RefSeq record:
NM_001318144.2
NBCI Gene record:
AQP3 (360)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318144.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434871 GGCTAAGGAGCTCCCTATCTA pLKO_005 827 3UTR 100% 5.625 7.875 N AQP3 n/a
2 TRCN0000434020 ATTGCGGGTGTCTTCGTGTAC pLKO_005 608 CDS 100% 4.050 5.670 N AQP3 n/a
3 TRCN0000059591 CCAACGAGGAAGAGAATGTGA pLKO.1 669 CDS 100% 3.000 4.200 N AQP3 n/a
4 TRCN0000435072 GAACCGGAATTTGGGTCAATA pLKO_005 934 3UTR 100% 13.200 9.240 N AQP3 n/a
5 TRCN0000415773 CCTTCTTGGGTGCTGGAATAG pLKO_005 398 CDS 100% 10.800 7.560 N AQP3 n/a
6 TRCN0000059590 CGGTGGTTTCCTCACCATCAA pLKO.1 222 CDS 100% 4.950 3.465 N AQP3 n/a
7 TRCN0000417941 TGGATCAAGCTGCCCATCTAC pLKO_005 355 CDS 100% 4.950 3.465 N AQP3 n/a
8 TRCN0000059589 TGGGCTGTATTATGATGCAAT pLKO.1 423 CDS 100% 4.950 3.465 N AQP3 n/a
9 TRCN0000059588 CAATGGCTTCTTTGACCAGTT pLKO.1 537 CDS 100% 4.050 2.835 N AQP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318144.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00089 pDONR223 100% 70.8% 56.7% None 492_493ins218;659_711del n/a
2 ccsbBroad304_00089 pLX_304 0% 70.8% 56.7% V5 492_493ins218;659_711del n/a
3 TRCN0000480907 AGCCCAGGAGCAACAAGGTCACTA pLX_317 53% 70.8% 56.7% V5 492_493ins218;659_711del n/a
Download CSV