Transcript: Human NM_001318192.2

Homo sapiens solute carrier family 13 member 4 (SLC13A4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SLC13A4 (26266)
Length:
2906
CDS:
691..2574

Additional Resources:

NCBI RefSeq record:
NM_001318192.2
NBCI Gene record:
SLC13A4 (26266)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322821 ACCCATCAGTCTGGATGTAAA pLKO_005 1221 CDS 100% 13.200 18.480 N SLC13A4 n/a
2 TRCN0000322823 TATTGGACTGGTGATAGTAAT pLKO_005 2463 CDS 100% 13.200 9.240 N SLC13A4 n/a
3 TRCN0000044840 CCAGAAATGGTGACTGGATTT pLKO.1 1816 CDS 100% 10.800 7.560 N SLC13A4 n/a
4 TRCN0000300976 CCAGAAATGGTGACTGGATTT pLKO_005 1816 CDS 100% 10.800 7.560 N SLC13A4 n/a
5 TRCN0000322885 CTGCCAGTATCCAGCAGTATC pLKO_005 2608 3UTR 100% 10.800 7.560 N SLC13A4 n/a
6 TRCN0000044842 CCTTCTCTGGAACTCATCTTT pLKO.1 1252 CDS 100% 5.625 3.938 N SLC13A4 n/a
7 TRCN0000300910 CCTTCTCTGGAACTCATCTTT pLKO_005 1252 CDS 100% 5.625 3.938 N SLC13A4 n/a
8 TRCN0000044841 CTGTCTGAAACGCTGCACATT pLKO.1 2296 CDS 100% 4.950 3.465 N SLC13A4 n/a
9 TRCN0000044838 GAACACTTCAACAACCAGTAT pLKO.1 1576 CDS 100% 4.950 3.465 N SLC13A4 n/a
10 TRCN0000044839 CCTCTCTACATGGATTGGGAA pLKO.1 2145 CDS 100% 2.640 1.848 N SLC13A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14108 pDONR223 100% 99.7% 2% None 12delG;594_596delCAG;737C>G n/a
2 ccsbBroad304_14108 pLX_304 0% 99.7% 2% V5 (not translated due to prior stop codon) 12delG;594_596delCAG;737C>G n/a
3 TRCN0000469642 ATAAGGCCGCCTTCACTAAACTGA pLX_317 21.2% 99.7% 2% V5 (not translated due to prior stop codon) 12delG;594_596delCAG;737C>G n/a
Download CSV