Transcript: Human NM_001318195.2

Homo sapiens NADH:ubiquinone oxidoreductase subunit A8 (NDUFA8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NDUFA8 (4702)
Length:
992
CDS:
103..489

Additional Resources:

NCBI RefSeq record:
NM_001318195.2
NBCI Gene record:
NDUFA8 (4702)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233281 ATTGGACTTGCATTGATTATA pLKO_005 356 CDS 100% 15.000 21.000 N NDUFA8 n/a
2 TRCN0000027159 CGCAAACAGCAGGCAAAGTTT pLKO.1 403 CDS 100% 5.625 4.500 N NDUFA8 n/a
3 TRCN0000027221 CGGTGTTTAGAGGAAGGCAAA pLKO.1 265 CDS 100% 4.050 3.240 N NDUFA8 n/a
4 TRCN0000238803 TAAGCCCAACAAGGAGTTTAT pLKO_005 213 CDS 100% 13.200 9.240 N NDUFA8 n/a
5 TRCN0000027190 CCCATCACTATGGAGCTCAAT pLKO.1 188 CDS 100% 4.950 3.465 N NDUFA8 n/a
6 TRCN0000027139 TCAATGTGATAAGCCCAACAA pLKO.1 204 CDS 100% 4.950 3.465 N NDUFA8 n/a
7 TRCN0000233282 ACGAGTGTGTGCTGGACAAAC pLKO_005 425 CDS 100% 10.800 6.480 N NDUFA8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06621 pDONR223 100% 73.6% 73.8% None 126G>A;219G>A;383_384delGGins134 n/a
2 ccsbBroad304_06621 pLX_304 0% 73.6% 73.8% V5 126G>A;219G>A;383_384delGGins134 n/a
3 TRCN0000476772 CTCAGAGCATCCGCGATCTTCGTC pLX_317 66.4% 73.6% 73.8% V5 126G>A;219G>A;383_384delGGins134 n/a
Download CSV