Transcript: Human NM_001318369.2

Homo sapiens solute carrier family 6 member 5 (SLC6A5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
SLC6A5 (9152)
Length:
6737
CDS:
629..2320

Additional Resources:

NCBI RefSeq record:
NM_001318369.2
NBCI Gene record:
SLC6A5 (9152)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318369.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043531 CCAACGTGACAATGGTTAATT pLKO.1 981 CDS 100% 15.000 21.000 N SLC6A5 n/a
2 TRCN0000043530 CGCAAAGTCAACATTGAGAAT pLKO.1 1517 CDS 100% 4.950 3.465 N SLC6A5 n/a
3 TRCN0000043528 GCCATATACTACAATGTGATT pLKO.1 776 CDS 100% 4.950 3.465 N SLC6A5 n/a
4 TRCN0000043529 GCAAAGATTCTGTGAAGATAT pLKO.1 1900 CDS 100% 13.200 7.920 N SLC6A5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318369.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07366 pDONR223 100% 70.5% 70.6% None (many diffs) n/a
2 ccsbBroad304_07366 pLX_304 0% 70.5% 70.6% V5 (many diffs) n/a
3 TRCN0000471680 GGCCAAACTTTGCAATACTTCTTT pLX_317 11.6% 70.5% 70.6% V5 (many diffs) n/a
Download CSV