Transcript: Human NM_001318514.1

Homo sapiens toll interacting protein (TOLLIP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
TOLLIP (54472)
Length:
3675
CDS:
382..999

Additional Resources:

NCBI RefSeq record:
NM_001318514.1
NBCI Gene record:
TOLLIP (54472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314643 CACACAATGGCGCCAAGAATC pLKO_005 446 CDS 100% 10.800 15.120 N TOLLIP n/a
2 TRCN0000356024 TCGAGATCTTCGATGAGAGAG pLKO_005 524 CDS 100% 4.050 5.670 N TOLLIP n/a
3 TRCN0000063696 CGACTGAACATCACGGTGGTA pLKO.1 334 5UTR 100% 2.640 2.112 N TOLLIP n/a
4 TRCN0000314642 GGCAAAGTTGGCCAAGAATTA pLKO_005 357 5UTR 100% 13.200 9.240 N TOLLIP n/a
5 TRCN0000314717 CCAACAAGATTCCCGTGAAAG pLKO_005 1073 3UTR 100% 10.800 7.560 N TOLLIP n/a
6 TRCN0000314718 ACGACAAGGAGGGCATGATCA pLKO_005 653 CDS 100% 4.950 3.465 N TOLLIP n/a
7 TRCN0000063693 CCGTGATATTAACAACTCTAA pLKO.1 2648 3UTR 100% 4.950 3.465 N TOLLIP n/a
8 TRCN0000063697 GAAAGCCATCCAGGACATGTT pLKO.1 876 CDS 100% 4.950 3.465 N TOLLIP n/a
9 TRCN0000314641 GAACAAGGATGCCGCCATCAA pLKO_005 948 CDS 100% 4.950 3.465 N TOLLIP n/a
10 TRCN0000356025 GGTCCTGATGCCAACAGTGTA pLKO_005 732 CDS 100% 4.950 3.465 N TOLLIP n/a
11 TRCN0000356013 TTCTCCATGGACGACCGCATT pLKO_005 547 CDS 100% 4.050 2.835 N TOLLIP n/a
12 TRCN0000356023 CCGCTGGAATAAGGTCATCCA pLKO_005 468 CDS 100% 2.640 1.848 N TOLLIP n/a
13 TRCN0000063694 CGTGGACTCTTTCTATCTCGA pLKO.1 507 CDS 100% 2.640 1.848 N TOLLIP n/a
14 TRCN0000063695 GCTGGAATAAGGTCATCCACT pLKO.1 470 CDS 100% 2.640 1.848 N TOLLIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03420 pDONR223 100% 74.8% 74.8% None 0_1ins207 n/a
2 ccsbBroad304_03420 pLX_304 0% 74.8% 74.8% V5 0_1ins207 n/a
3 TRCN0000466589 GATTTGCACCTTAGACAGGGGGTC pLX_317 28.7% 74.8% 74.8% V5 0_1ins207 n/a
4 ccsbBroadEn_08382 pDONR223 100% 74.6% 74.8% None 0_1ins207;210G>A n/a
5 ccsbBroad304_08382 pLX_304 0% 74.6% 74.8% V5 0_1ins207;210G>A n/a
6 TRCN0000479669 GATAAACAAGTCATTGATCTGGAA pLX_317 38% 74.6% 74.8% V5 0_1ins207;210G>A n/a
Download CSV