Construct: ORF TRCN0000466589
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000560.1_s317c1
- Derived from:
- ccsbBroadEn_03420
- DNA Barcode:
- GATTTGCACCTTAGACAGGGGGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TOLLIP (54472)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466589
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54472 | TOLLIP | toll interacting protein | NM_019009.4 | 100% | 100% | |
| 2 | human | 54472 | TOLLIP | toll interacting protein | NM_001318512.2 | 81.7% | 81.7% | 32_33ins150 |
| 3 | human | 54472 | TOLLIP | toll interacting protein | NM_001318516.2 | 77.7% | 77.7% | 181_182ins183 |
| 4 | human | 54472 | TOLLIP | toll interacting protein | NM_001318514.1 | 74.8% | 74.8% | 0_1ins207 |
| 5 | human | 54472 | TOLLIP | toll interacting protein | XM_017017931.1 | 54% | 54% | 0_1ins378 |
| 6 | human | 54472 | TOLLIP | toll interacting protein | NM_001318515.2 | 29.1% | 24.8% | 179_180ins427;240_241ins155 |
| 7 | human | 54472 | TOLLIP | toll interacting protein | XR_001747910.2 | 16.6% | 1_125del;490_1820del;2279_4949del | |
| 8 | mouse | 54473 | Tollip | toll interacting protein | NM_023764.3 | 86% | 92.7% | (many diffs) |
| 9 | mouse | 54473 | Tollip | toll interacting protein | NM_001347562.1 | 83.7% | 89% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 888
- ORF length:
- 822
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gaccaccgtc agcactcagc gcgggccggt gtacatcggt gagctcccgc 121 aggacttcct ccgcatcacg cccacacagc agcagcggca ggtccagctg gacgcccagg 181 cggcccagca gctgcagtac ggaggcgcag tgggcaccgt gggccgactg aacatcacgg 241 tggtacaggc aaagttggcc aagaattacg gcatgacccg catggacccc tactgccgac 301 tgcgcctggg ctacgcggtg tacgagacgc ccacggcaca caatggcgcc aagaatcccc 361 gctggaataa ggtcatccac tgcacggtgc ccccaggcgt ggactctttc tatctcgaga 421 tcttcgatga gagagccttc tccatggacg accgcattgc ctggacccac atcaccatcc 481 cggagtccct gaggcagggc aaggtggagg acaagtggta cagcctgagc gggaggcagg 541 gggacgacaa ggagggcatg atcaacctcg tcatgtccta cgcgctgctt ccagctgcca 601 tggtgatgcc accccagccc gtggtcctga tgccaacagt gtaccagcag ggcgttGGCT 661 ATGTGCCCAT CACAGGGATG CCCGCTGTCT GTAGCCCCGG CATGGTGCCC GTGGCCCTGC 721 CCCCGGCCGC CGTGAACGCC CAGCCCCGCT GTAGCGAGGA GGACCTGAAA GCCATCCAGG 781 ACATGTTCCC CAACATGGAC CAGGAGGTGA TCCGCTCCGT GCTGGAAGCC CAGCGAGGGA 841 ACAAGGATGC CGCCATCAAC TCCCTGCTGC AGATGGGGGA GGAGCCATAC CCAACTTTCT 901 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 961 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1021 GTGGAAAGGA CGAGATTTGC ACCTTAGACA GGGGGTCACG CGTTAAGTCg acaatcaacc 1081 tctggattac aaaatttgtg aaagatt