Transcript: Human NM_001318515.2

Homo sapiens toll interacting protein (TOLLIP), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
TOLLIP (54472)
Length:
3200
CDS:
135..377

Additional Resources:

NCBI RefSeq record:
NM_001318515.2
NBCI Gene record:
TOLLIP (54472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063696 CGACTGAACATCACGGTGGTA pLKO.1 294 CDS 100% 2.640 2.112 N TOLLIP n/a
2 TRCN0000314717 CCAACAAGATTCCCGTGAAAG pLKO_005 606 3UTR 100% 10.800 7.560 N TOLLIP n/a
3 TRCN0000063693 CCGTGATATTAACAACTCTAA pLKO.1 2181 3UTR 100% 4.950 3.465 N TOLLIP n/a
4 TRCN0000063697 GAAAGCCATCCAGGACATGTT pLKO.1 409 3UTR 100% 4.950 3.465 N TOLLIP n/a
5 TRCN0000314641 GAACAAGGATGCCGCCATCAA pLKO_005 481 3UTR 100% 4.950 3.465 N TOLLIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03420 pDONR223 100% 29.1% 24.8% None 179_180ins427;240_241ins155 n/a
2 ccsbBroad304_03420 pLX_304 0% 29.1% 24.8% V5 179_180ins427;240_241ins155 n/a
3 TRCN0000466589 GATTTGCACCTTAGACAGGGGGTC pLX_317 28.7% 29.1% 24.8% V5 179_180ins427;240_241ins155 n/a
4 ccsbBroadEn_08382 pDONR223 100% 29.1% 24.8% None 179_180ins427;240_241ins155 n/a
5 ccsbBroad304_08382 pLX_304 0% 29.1% 24.8% V5 179_180ins427;240_241ins155 n/a
6 TRCN0000479669 GATAAACAAGTCATTGATCTGGAA pLX_317 38% 29.1% 24.8% V5 179_180ins427;240_241ins155 n/a
Download CSV