Transcript: Human NM_001318729.1

Homo sapiens glycoprotein M6B (GPM6B), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
GPM6B (2824)
Length:
3105
CDS:
315..1124

Additional Resources:

NCBI RefSeq record:
NM_001318729.1
NBCI Gene record:
GPM6B (2824)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430456 TCCGACAATACGGTATCATTC pLKO_005 823 CDS 100% 10.800 15.120 N GPM6B n/a
2 TRCN0000063816 CCGATGCATCAGTGGAATGTT pLKO.1 644 CDS 100% 5.625 7.875 N GPM6B n/a
3 TRCN0000091445 GTCTTCTAACTGGGCTTACTT pLKO.1 995 CDS 100% 5.625 3.938 N Gpm6b n/a
4 TRCN0000063814 GCCCGTGTTTATGTTCTACAA pLKO.1 725 CDS 100% 4.950 3.465 N GPM6B n/a
5 TRCN0000063817 GTGATACAACTGATGCAGTAT pLKO.1 504 CDS 100% 4.950 3.465 N GPM6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00668 pDONR223 100% 71.1% 69.2% None (many diffs) n/a
2 ccsbBroad304_00668 pLX_304 0% 71.1% 69.2% V5 (many diffs) n/a
3 TRCN0000470278 AGTCGACGGCATAAACCGTTCCGG pLX_317 37.1% 71.1% 69.2% V5 (many diffs) n/a
Download CSV