Transcript: Human NM_001318786.2

Homo sapiens cytochrome c oxidase subunit 4I1 (COX4I1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
COX4I1 (1327)
Length:
770
CDS:
81..590

Additional Resources:

NCBI RefSeq record:
NM_001318786.2
NBCI Gene record:
COX4I1 (1327)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232553 AGTCGAGTTGTATCGCATTAA pLKO_005 314 CDS 100% 13.200 18.480 N COX4I1 n/a
2 TRCN0000232551 TAGTTGGCAAGCGAGCAATTT pLKO_005 106 CDS 100% 13.200 18.480 N COX4I1 n/a
3 TRCN0000046289 CGAGTTGTATCGCATTAAGTT pLKO.1 317 CDS 100% 5.625 7.875 N COX4I1 n/a
4 TRCN0000046288 GCTCGTTATCATGTGGCAGAA pLKO.1 425 CDS 100% 4.050 5.670 N COX4I1 n/a
5 TRCN0000232555 TCCCGCAAAGCTTTGACAAAG pLKO_005 466 CDS 100% 10.800 8.640 N COX4I1 n/a
6 TRCN0000046290 AGCTCATGAAAGTGTTGTGAA pLKO.1 146 CDS 100% 4.950 3.960 N COX4I1 n/a
7 TRCN0000046292 GCCTCCAAGTGGGACTACGAA pLKO.1 549 CDS 100% 1.000 0.800 N COX4I1 n/a
8 TRCN0000232552 GTGTGTACGAGCTCATGAAAG pLKO_005 137 CDS 100% 10.800 7.560 N COX4I1 n/a
9 TRCN0000232554 GCCATGTTCTTCATCGGTTTC pLKO_005 399 CDS 100% 6.000 4.200 N COX4I1 n/a
10 TRCN0000046291 TGCCATGTTCTTCATCGGTTT pLKO.1 398 CDS 100% 4.050 2.835 N COX4I1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00349 pDONR223 100% 99.8% 100% None 184T>C n/a
2 ccsbBroad304_00349 pLX_304 0% 99.8% 100% V5 184T>C n/a
3 TRCN0000471263 AAACACACACGCACATCCCTCCTT pLX_317 85.3% 99.8% 100% V5 184T>C n/a
4 ccsbBroadEn_10745 pDONR223 100% 47.8% 47.6% None 184T>C;242_242delTinsGTGG;247_507del n/a
5 ccsbBroad304_10745 pLX_304 0% 47.8% 47.6% V5 184T>C;242_242delTinsGTGG;247_507del n/a
6 TRCN0000472274 TGGGGGCTCTTGACCGAATGAGAG pLX_317 100% 47.8% 47.6% V5 184T>C;242_242delTinsGTGG;247_507del n/a
Download CSV