Transcript: Human NM_001318819.2

Homo sapiens BRD4 interacting chromatin remodeling complex associated protein like (BICRAL), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
BICRAL (23506)
Length:
6751
CDS:
402..3641

Additional Resources:

NCBI RefSeq record:
NM_001318819.2
NBCI Gene record:
BICRAL (23506)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263358 ACACCACGTCCAGACTATAAA pLKO_005 1643 CDS 100% 15.000 21.000 N BICRAL n/a
2 TRCN0000263357 ATTAGTGGTTCTGGTCAAATA pLKO_005 1020 CDS 100% 13.200 18.480 N BICRAL n/a
3 TRCN0000168820 CCGTTCCATTTAACAGCACAA pLKO.1 1237 CDS 100% 4.050 5.670 N BICRAL n/a
4 TRCN0000263359 ATTGGCAGAAGAGGCATATTT pLKO_005 758 CDS 100% 15.000 12.000 N BICRAL n/a
5 TRCN0000263360 TCTACATGGACCTAGTAATAA pLKO_005 467 CDS 100% 15.000 10.500 N BICRAL n/a
6 TRCN0000168006 CATCCTTTACTCAGGCTTCTA pLKO.1 841 CDS 100% 4.950 3.465 N BICRAL n/a
7 TRCN0000282587 ATAGAGCCATGAGGGTTATAA pLKO_005 4481 3UTR 100% 15.000 9.000 N BICRAL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318819.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02782 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02782 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480900 CTATATCGACACCAGCGATAGCGC pLX_317 12.8% 100% 100% V5 n/a
Download CSV