Transcript: Human NM_001318865.2

Homo sapiens glycine N-methyltransferase (GNMT), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
GNMT (27232)
Length:
1019
CDS:
15..845

Additional Resources:

NCBI RefSeq record:
NM_001318865.2
NBCI Gene record:
GNMT (27232)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000326 CAGACGGAAGGGTAAACAATA pLKO.1 978 3UTR 100% 13.200 6.600 Y GNMT n/a
2 TRCN0000432580 GTGACAAGATGCTGAAGTATG pLKO_005 277 CDS 100% 10.800 5.400 Y GNMT n/a
3 TRCN0000416429 ACTTGACCAAGGACGTCACAA pLKO_005 556 CDS 100% 4.950 2.475 Y GNMT n/a
4 TRCN0000000330 CCTACATTCCCTGCTACTTCA pLKO.1 799 CDS 100% 4.950 2.475 Y GNMT n/a
5 TRCN0000412313 GACAAGTGGGTCATCGAAGAA pLKO_005 339 CDS 100% 4.950 2.475 Y GNMT n/a
6 TRCN0000430400 GCCTACTGGTCATTGATCATC pLKO_005 469 CDS 100% 4.950 2.475 Y GNMT n/a
7 TRCN0000000329 CATTCCCTGCTACTTCATCCA pLKO.1 803 CDS 100% 2.640 1.320 Y GNMT n/a
8 TRCN0000000327 CCAAACCTACATTCCCTGCTA pLKO.1 794 CDS 100% 2.640 1.320 Y GNMT n/a
9 TRCN0000000328 GATAGTGAACAACAAGGCCCA pLKO.1 587 CDS 100% 0.540 0.270 Y GNMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03008 pDONR223 100% 93.5% 93.5% None 449_450ins57 n/a
2 ccsbBroad304_03008 pLX_304 0% 93.5% 93.5% V5 449_450ins57 n/a
3 TRCN0000492110 TTAATCGAGTGAAGGAAGAGGATT pLX_317 50.4% 93.5% 93.5% V5 449_450ins57 n/a
Download CSV