Transcript: Human NM_001318941.2

Homo sapiens tissue factor pathway inhibitor (TFPI), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
TFPI (7035)
Length:
1210
CDS:
340..1095

Additional Resources:

NCBI RefSeq record:
NM_001318941.2
NBCI Gene record:
TFPI (7035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073584 CGAGGTTATATTACCAGGTAT pLKO.1 742 CDS 100% 4.950 6.930 N TFPI n/a
2 TRCN0000291639 CGAGGTTATATTACCAGGTAT pLKO_005 742 CDS 100% 4.950 6.930 N TFPI n/a
3 TRCN0000073585 CCTGGGCAATATGAACAATTT pLKO.1 813 CDS 100% 13.200 9.240 N TFPI n/a
4 TRCN0000333214 CCTGGGCAATATGAACAATTT pLKO_005 813 CDS 100% 13.200 9.240 N TFPI n/a
5 TRCN0000073586 TCCTGGAATATGTCGAGGTTA pLKO.1 729 CDS 100% 4.950 3.465 N TFPI n/a
6 TRCN0000291638 TCCTGGAATATGTCGAGGTTA pLKO_005 729 CDS 100% 4.950 3.465 N TFPI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318941.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07053 pDONR223 100% 99.8% 100% None 24A>C n/a
2 ccsbBroad304_07053 pLX_304 0% 99.8% 100% V5 24A>C n/a
3 TRCN0000471352 GCCTAATAACGGGATTTTCCATGG pLX_317 66.1% 99.8% 100% V5 24A>C n/a
Download CSV