Transcript: Human NM_001319059.2

Homo sapiens glutathione S-transferase alpha 1 (GSTA1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
GSTA1 (2938)
Length:
1085
CDS:
209..598

Additional Resources:

NCBI RefSeq record:
NM_001319059.2
NBCI Gene record:
GSTA1 (2938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414342 TGTCCCGTAACATACAATTTG pLKO_005 899 3UTR 100% 13.200 9.240 N GSTA1 n/a
2 TRCN0000436226 ACAACTCCTATTCGCTGACTT pLKO_005 736 3UTR 100% 4.950 3.465 N GSTA1 n/a
3 TRCN0000431385 GAACTTGCAATACCAATGTTC pLKO_005 620 3UTR 100% 4.950 3.465 N GSTA1 n/a
4 TRCN0000163317 GCCAAGCTTGCCTTGATCAAA pLKO.1 284 CDS 100% 5.625 3.375 N GSTA1 n/a
5 TRCN0000162011 GCTTGCCTTGATCAAAGAGAA pLKO.1 289 CDS 100% 4.950 2.970 N GSTA1 n/a
6 TRCN0000152045 CCCATGGATGAGAAATCTTTA pLKO.1 548 CDS 100% 13.200 6.600 Y GSTA2 n/a
7 TRCN0000160006 CCCATGGATGAGAAATCTTTA pLKO.1 548 CDS 100% 13.200 6.600 Y GSTA5 n/a
8 TRCN0000159861 GAGTAGAGTTTGAAGAGAAAT pLKO.1 142 5UTR 100% 13.200 6.600 Y GSTA1 n/a
9 TRCN0000163660 GCAGCTGGAGTAGAGTTTGAA pLKO.1 135 5UTR 100% 5.625 2.813 Y GSTA1 n/a
10 TRCN0000162921 GCTACTTCCCTGCCTTTGAAA pLKO.1 321 CDS 100% 5.625 2.813 Y GSTA1 n/a
11 TRCN0000123276 CATGGACAAGACTACCTTGTT pLKO.1 356 CDS 100% 0.495 0.248 Y GSTA3 n/a
12 TRCN0000160709 CATGGACAAGACTACCTTGTT pLKO.1 356 CDS 100% 0.495 0.248 Y GSTA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00701 pDONR223 100% 58.1% 58.1% None 0_1ins279 n/a
2 ccsbBroad304_00701 pLX_304 0% 58.1% 58.1% V5 0_1ins279 n/a
3 TRCN0000469010 TTTTTAGACCATACGTGGGATTTT pLX_317 51.7% 58.1% 58.1% V5 0_1ins279 n/a
4 ccsbBroadEn_06330 pDONR223 100% 55.4% 54.9% None (many diffs) n/a
5 ccsbBroad304_06330 pLX_304 0% 55.4% 54.9% V5 (many diffs) n/a
6 TRCN0000467221 TTACCGAGATCTCTTTTCATATCT pLX_317 52.1% 55.4% 54.9% V5 (many diffs) n/a
Download CSV