Transcript: Human NM_001319138.2

Homo sapiens growth differentiation factor 5 (GDF5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
GDF5 (8200)
Length:
2575
CDS:
508..2013

Additional Resources:

NCBI RefSeq record:
NM_001319138.2
NBCI Gene record:
GDF5 (8200)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058346 CAGGACGATAAGACCGTGTAT pLKO.1 1597 CDS 100% 4.950 6.930 N GDF5 n/a
2 TRCN0000058343 GCAGAGGTACGTGTTTGACAT pLKO.1 1164 CDS 100% 4.950 6.930 N GDF5 n/a
3 TRCN0000058344 CAACACCATCACCAGCTTTAT pLKO.1 1104 CDS 100% 13.200 9.240 N GDF5 n/a
4 TRCN0000378765 ATGAGACTCAGCCCACCATTT pLKO_005 2307 3UTR 100% 10.800 7.560 N GDF5 n/a
5 TRCN0000378693 TGAGTGTGACTTGGGCTAAAG pLKO_005 2158 3UTR 100% 10.800 7.560 N GDF5 n/a
6 TRCN0000372297 AGGCAACAGCAGCGTGAAGTT pLKO_005 1068 CDS 100% 4.950 3.465 N GDF5 n/a
7 TRCN0000058345 CCTCTTCATTGACTCTGCCAA pLKO.1 1935 CDS 100% 2.640 1.848 N GDF5 n/a
8 TRCN0000058347 CCTGGAATTCATCTGCACTGT pLKO.1 561 CDS 100% 0.000 0.000 N GDF5 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 113 5UTR 100% 4.950 2.475 Y n/a
10 TRCN0000068119 GCCAACAACGTGGTGTATAAA pLKO.1 1951 CDS 100% 15.000 10.500 N Gdf5 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 184 5UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 184 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07207 pDONR223 100% 99.8% 99.8% None 826G>T;1017A>G;1401G>T n/a
2 ccsbBroad304_07207 pLX_304 0% 99.8% 99.8% V5 826G>T;1017A>G;1401G>T n/a
3 TRCN0000474107 CTGCGGTCCACTTGAGTATAATGT pLX_317 1.5% 99.8% 99.8% V5 826G>T;1017A>G;1401G>T n/a
Download CSV