Transcript: Human NM_001319216.2

Homo sapiens cytochrome P450 family 1 subfamily A member 1 (CYP1A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CYP1A1 (1543)
Length:
2516
CDS:
118..1569

Additional Resources:

NCBI RefSeq record:
NM_001319216.2
NBCI Gene record:
CYP1A1 (1543)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428932 ACATCGTCTTGGACCTCTTTG pLKO_005 1043 CDS 100% 10.800 15.120 N CYP1A1 n/a
2 TRCN0000431185 CAAATGCAGCTGCGCTCTTAG pLKO_005 1549 CDS 100% 10.800 8.640 N CYP1A1 n/a
3 TRCN0000064619 GCCTAGTCAACCTGAATAATA pLKO.1 764 CDS 100% 15.000 10.500 N CYP1A1 n/a
4 TRCN0000064621 CTGTCTGGTATTCTGGGTAAT pLKO.1 174 CDS 100% 10.800 7.560 N CYP1A1 n/a
5 TRCN0000064618 GCTGACTTCATCCCTATTCTT pLKO.1 817 CDS 100% 5.625 3.938 N CYP1A1 n/a
6 TRCN0000064620 CGACAAGGTGTTAAGTGAGAA pLKO.1 1347 CDS 100% 4.950 2.970 N CYP1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00406 pDONR223 100% 94.3% 94.1% None 1166_1167ins87 n/a
2 ccsbBroad304_00406 pLX_304 0% 94.3% 94.1% V5 1166_1167ins87 n/a
3 TRCN0000473866 GCATCAGCGATCAATTACCGGTCT pLX_317 30.5% 94.3% 94.1% V5 1166_1167ins87 n/a
Download CSV