Transcript: Human NM_001319240.1

Homo sapiens uncharacterized LOC100287896 (LOC100287896), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LOC100287896 (100287896)
Length:
2489
CDS:
847..2025

Additional Resources:

NCBI RefSeq record:
NM_001319240.1
NBCI Gene record:
LOC100287896 (100287896)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146901 CTGAAAGTGATGAGCAGATAT pLKO.1 1184 CDS 100% 13.200 9.240 N LOC100287896 n/a
2 TRCN0000148306 CATTGTCCAATGGTGAAGTAA pLKO.1 1670 CDS 100% 5.625 3.938 N LOC100287896 n/a
3 TRCN0000148015 GAGCAAGAAATCATGTCAGTT pLKO.1 1834 CDS 100% 4.950 3.465 N LOC100287896 n/a
4 TRCN0000147679 GCATTCATAACAGAGCAAGAA pLKO.1 1822 CDS 100% 4.950 3.465 N LOC100287896 n/a
5 TRCN0000148103 GCTGATCATGAAACAAGCAAA pLKO.1 1314 CDS 100% 4.950 3.465 N LOC100287896 n/a
6 TRCN0000147194 CATTCATTGTCCAATGGTGAA pLKO.1 1666 CDS 100% 4.050 2.835 N LOC100287896 n/a
7 TRCN0000147977 GTTTACTGGCAAGTTCAGTAA pLKO.1 1476 CDS 100% 0.495 0.347 N LOC100287896 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13626 pDONR223 100% 76% 76% None 1_282del n/a
2 ccsbBroad304_13626 pLX_304 0% 76% 76% V5 1_282del n/a
3 TRCN0000473074 GTCGCCGGGCCAGAGCTTCTTCTT pLX_317 42.3% 76% 76% V5 1_282del n/a
Download CSV