Transcript: Human NM_001320044.2

Homo sapiens SREBF chaperone (SCAP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SCAP (22937)
Length:
3766
CDS:
522..3593

Additional Resources:

NCBI RefSeq record:
NM_001320044.2
NBCI Gene record:
SCAP (22937)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078067 TGCTTAATTGACACCAACTTT pLKO.1 2376 CDS 100% 5.625 7.875 N SCAP n/a
2 TRCN0000296200 CCGACGCTCTTCAGCTATTAC pLKO_005 1656 CDS 100% 13.200 9.240 N SCAP n/a
3 TRCN0000078066 GCTCAACGGTTCCCTTGATTT pLKO.1 2825 CDS 100% 13.200 9.240 N SCAP n/a
4 TRCN0000289345 GCTCAACGGTTCCCTTGATTT pLKO_005 2825 CDS 100% 13.200 9.240 N SCAP n/a
5 TRCN0000078064 GCTGCCATTGTCTGCAACTTT pLKO.1 3519 CDS 100% 5.625 3.938 N SCAP n/a
6 TRCN0000289278 GCTGCCATTGTCTGCAACTTT pLKO_005 3519 CDS 100% 5.625 3.938 N SCAP n/a
7 TRCN0000078065 GATGAGGAACTTTGGAGGAAA pLKO.1 1617 CDS 100% 4.950 3.465 N SCAP n/a
8 TRCN0000078063 GCTCTGGTGTTCTTGGACAAA pLKO.1 2787 CDS 100% 4.950 3.465 N SCAP n/a
9 TRCN0000289279 GCTCTGGTGTTCTTGGACAAA pLKO_005 2787 CDS 100% 4.950 3.465 N SCAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11654 pDONR223 100% 87.6% 85.7% None (many diffs) n/a
2 ccsbBroad304_11654 pLX_304 0% 87.6% 85.7% V5 (many diffs) n/a
3 TRCN0000472230 TAGGTACTACCCCAAAGTACTAAA pLX_317 12.8% 87.6% 85.7% V5 (many diffs) n/a
Download CSV