Transcript: Human NM_001320144.2

Homo sapiens TRAF3 interacting protein 3 (TRAF3IP3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TRAF3IP3 (80342)
Length:
2174
CDS:
417..2012

Additional Resources:

NCBI RefSeq record:
NM_001320144.2
NBCI Gene record:
TRAF3IP3 (80342)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320144.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218531 GGACCTACAAGATCAACTAAA pLKO_005 1535 CDS 100% 13.200 18.480 N TRAF3IP3 n/a
2 TRCN0000368869 GGACCTACAAGATCAACTAAA pLKO_005 1535 CDS 100% 13.200 18.480 N Traf3ip3 n/a
3 TRCN0000229286 CAGGCAAGAGATCCGTGAAAG pLKO_005 491 CDS 100% 10.800 15.120 N TRAF3IP3 n/a
4 TRCN0000037752 GCCGTCCCAATGTGACCACTT pLKO.1 520 CDS 100% 1.350 1.890 N TRAF3IP3 n/a
5 TRCN0000229288 ACAACCTCAGTGACGAGTATC pLKO_005 1831 CDS 100% 10.800 7.560 N TRAF3IP3 n/a
6 TRCN0000229287 ATGAACCAGGCCCTGCGATTT pLKO_005 1434 CDS 100% 10.800 7.560 N TRAF3IP3 n/a
7 TRCN0000037753 CAGCTTCAAGAACAGGAGAAA pLKO.1 1632 CDS 100% 4.950 3.465 N TRAF3IP3 n/a
8 TRCN0000037751 GCTATACACCTGTACCCAGAA pLKO.1 1112 CDS 100% 4.050 2.835 N TRAF3IP3 n/a
9 TRCN0000037750 CCAAAGTCCTTCCCTAACGAA pLKO.1 1692 CDS 100% 3.000 2.100 N TRAF3IP3 n/a
10 TRCN0000257397 ATAATTTGTGACAACTGCCTT pLKO_005 2013 CDS 100% 2.640 1.848 N TRAF3IP3 n/a
11 TRCN0000037749 GCCAAGATTGAATGCCTGCAA pLKO.1 1482 CDS 100% 2.640 1.848 N TRAF3IP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320144.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09033 pDONR223 100% 96.3% 96.1% None 282_283ins60;1057C>G n/a
2 ccsbBroad304_09033 pLX_304 0% 96.3% 96.1% V5 (not translated due to prior stop codon) 282_283ins60;1057C>G n/a
3 ccsbBroadEn_12697 pDONR223 100% 60.1% 60% None (many diffs) n/a
4 ccsbBroad304_12697 pLX_304 0% 60.1% 60% V5 (many diffs) n/a
5 TRCN0000475916 GTCAACTCATTAAACTGCACCAAA pLX_317 13.9% 60.1% 60% V5 (many diffs) n/a
Download CSV