Transcript: Human NM_001320220.2

Homo sapiens U2 snRNP associated SURP domain containing (U2SURP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
U2SURP (23350)
Length:
7380
CDS:
1243..3105

Additional Resources:

NCBI RefSeq record:
NM_001320220.2
NBCI Gene record:
U2SURP (23350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336771 AGATCCAAGCACTACTAATTT pLKO_005 866 5UTR 100% 15.000 21.000 N U2SURP n/a
2 TRCN0000336769 TCTTGATGGAGTCCCTATAAA pLKO_005 2184 CDS 100% 15.000 21.000 N U2SURP n/a
3 TRCN0000336772 ACGAGCCAAACTTCGTGAAAT pLKO_005 2535 CDS 100% 13.200 18.480 N U2SURP n/a
4 TRCN0000221604 GCAGTGGTAGACGAGTGAAAT pLKO.1 2831 CDS 100% 13.200 18.480 N U2SURP n/a
5 TRCN0000221601 GCCCTGATACATCGAATGATA pLKO.1 1300 CDS 100% 5.625 7.875 N U2SURP n/a
6 TRCN0000221605 CGTACAATTCAAGGCCATTTA pLKO.1 1918 CDS 100% 13.200 10.560 N U2SURP n/a
7 TRCN0000336768 CGTACAATTCAAGGCCATTTA pLKO_005 1918 CDS 100% 13.200 10.560 N U2SURP n/a
8 TRCN0000336770 TACTTTCATTGTGGCTATTTC pLKO_005 3295 3UTR 100% 13.200 9.240 N U2SURP n/a
9 TRCN0000103869 GCAATTTATCCAGAACCATTT pLKO.1 1996 CDS 100% 10.800 7.560 N U2surp n/a
10 TRCN0000221603 GCAGGGAGATTCTCCAACTAA pLKO.1 1458 CDS 100% 5.625 3.938 N U2SURP n/a
11 TRCN0000221602 GCTGAGATTTATGAGGAGTTT pLKO.1 399 5UTR 100% 4.950 3.465 N U2SURP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11725 pDONR223 100% 99.9% 100% None 78A>T n/a
2 ccsbBroad304_11725 pLX_304 0% 99.9% 100% V5 78A>T n/a
3 TRCN0000479492 AGACACCAACCGTTCTGATGTGGT pLX_317 16.1% 99.9% 100% V5 78A>T n/a
Download CSV