Transcript: Human NM_001320613.2

Homo sapiens adenylate cyclase 3 (ADCY3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
ADCY3 (109)
Length:
4953
CDS:
753..4190

Additional Resources:

NCBI RefSeq record:
NM_001320613.2
NBCI Gene record:
ADCY3 (109)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320613.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420178 AGAGTCCGCCCAAGTAGTAAA pLKO_005 2543 CDS 100% 13.200 18.480 N ADCY3 n/a
2 TRCN0000078337 GTCTGCGTTTCCTCAATGAAA pLKO.1 3598 CDS 100% 5.625 7.875 N ADCY3 n/a
3 TRCN0000078333 CCCTTAGTCATGAGAACAGAA pLKO.1 4703 3UTR 100% 4.950 6.930 N ADCY3 n/a
4 TRCN0000078334 GCGTCCCGTCTTTGATGAATA pLKO.1 3137 CDS 100% 13.200 9.240 N ADCY3 n/a
5 TRCN0000418708 ACCTAGAAGAGAAGGGTATTG pLKO_005 2194 CDS 100% 10.800 7.560 N ADCY3 n/a
6 TRCN0000427265 GTGCCTTCCAAGTACTCTATG pLKO_005 3261 CDS 100% 10.800 7.560 N ADCY3 n/a
7 TRCN0000078335 CCCTGGCTAATGACAAACTAT pLKO.1 2715 CDS 100% 5.625 3.938 N ADCY3 n/a
8 TRCN0000078336 GCAGTTCAACACCATGTACAT pLKO.1 1667 CDS 100% 4.950 3.465 N ADCY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320613.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00024 pDONR223 100% 99.9% 99.9% None 2493_2495delCAG n/a
2 ccsbBroad304_00024 pLX_304 0% 99.9% 99.9% V5 (not translated due to frame shift) 2493_2495delCAG n/a
Download CSV