Transcript: Human NM_001320729.2

Homo sapiens zinc finger and BTB domain containing 21 (ZBTB21), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
ZBTB21 (49854)
Length:
6784
CDS:
123..2720

Additional Resources:

NCBI RefSeq record:
NM_001320729.2
NBCI Gene record:
ZBTB21 (49854)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235883 GACCGAAGATTGCCGTTTAAG pLKO_005 1587 CDS 100% 13.200 18.480 N ZBTB21 n/a
2 TRCN0000019988 CCTTTCTGACTAACATCGTTT pLKO.1 457 CDS 100% 4.950 6.930 N ZBTB21 n/a
3 TRCN0000019985 GCAGCGAATACTTTCAGAGTT pLKO.1 274 CDS 100% 4.950 6.930 N ZBTB21 n/a
4 TRCN0000019984 CGAGAGCAAGTGTGAGTATAA pLKO.1 1817 CDS 100% 13.200 10.560 N ZBTB21 n/a
5 TRCN0000235881 CTATTCACCTTCCATAGATTT pLKO_005 1178 CDS 100% 13.200 10.560 N ZBTB21 n/a
6 TRCN0000235882 GTTTGGAATGGAACGTTTATA pLKO_005 5634 3UTR 100% 15.000 10.500 N ZBTB21 n/a
7 TRCN0000235879 AGTCAAGGCCAATACCAATAA pLKO_005 665 CDS 100% 13.200 9.240 N ZBTB21 n/a
8 TRCN0000019986 CCCAAGAATCAGACACCCTTT pLKO.1 2581 CDS 100% 4.050 2.835 N ZBTB21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08173 pDONR223 100% 81.1% 81% None 1602_1603ins603;2278T>C n/a
2 ccsbBroad304_08173 pLX_304 0% 81.1% 81% V5 1602_1603ins603;2278T>C n/a
3 TRCN0000476213 ACATGGAGTCGCCGAATTATCACG pLX_317 10.1% 81.1% 81% V5 1602_1603ins603;2278T>C n/a
Download CSV