Transcript: Human NM_001320752.2

Homo sapiens steroid sulfatase (STS), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
STS (412)
Length:
6622
CDS:
506..2242

Additional Resources:

NCBI RefSeq record:
NM_001320752.2
NBCI Gene record:
STS (412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320752.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419308 GCTTCTGTTTCGGGAGTTATG pLKO_005 1950 CDS 100% 10.800 15.120 N STS n/a
2 TRCN0000430776 TATGTCAACAGTATAAGTTAC pLKO_005 2623 3UTR 100% 10.800 15.120 N STS n/a
3 TRCN0000050828 CCCACCGATGAGATTACCTTT pLKO.1 824 CDS 100% 4.950 6.930 N STS n/a
4 TRCN0000425886 ACTAGCAACATGGACATATTT pLKO_005 1682 CDS 100% 15.000 10.500 N STS n/a
5 TRCN0000423367 ATGCAATAACCAGCATAATAA pLKO_005 2667 3UTR 100% 15.000 10.500 N STS n/a
6 TRCN0000050829 CCTTTACATCACGGCTTCAAT pLKO.1 941 CDS 100% 5.625 3.938 N STS n/a
7 TRCN0000050832 GAGCTGAGATTGGCTAATGAT pLKO.1 1472 CDS 100% 5.625 3.938 N STS n/a
8 TRCN0000050831 CCTGTTCTCCAGCAAAGACTT pLKO.1 1366 CDS 100% 4.950 3.465 N STS n/a
9 TRCN0000050830 CCAGAGAGAGAAACCCACTTA pLKO.1 2016 CDS 100% 4.950 3.465 N STS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320752.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05851 pDONR223 100% 99% 99.1% None 0_1insATGCCTTTAAGGAAG;1272G>A n/a
2 ccsbBroad304_05851 pLX_304 0% 99% 99.1% V5 0_1insATGCCTTTAAGGAAG;1272G>A n/a
3 TRCN0000476278 GCATTAGTCACCGACGTAGTGGCC pLX_317 20.2% 99% 99.1% V5 0_1insATGCCTTTAAGGAAG;1272G>A n/a
Download CSV