Transcript: Human NM_001320766.2

Homo sapiens listerin E3 ubiquitin protein ligase 1 (LTN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
LTN1 (26046)
Length:
7635
CDS:
73..5331

Additional Resources:

NCBI RefSeq record:
NM_001320766.2
NBCI Gene record:
LTN1 (26046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320766.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344637 TCTGTAAACTCGCAGATATAA pLKO_005 1853 CDS 100% 15.000 21.000 N LTN1 n/a
2 TRCN0000312611 ACTTGATTGGAGACGTATATG pLKO_005 2387 CDS 100% 13.200 18.480 N LTN1 n/a
3 TRCN0000312544 AGTCTGTAAACTCGCAGATAT pLKO_005 1851 CDS 100% 13.200 18.480 N LTN1 n/a
4 TRCN0000296420 TACTTGATTGGAGACGTATAT pLKO_005 2386 CDS 100% 13.200 18.480 N LTN1 n/a
5 TRCN0000344691 GTATGATCAGGATAATCTAAA pLKO_005 4272 CDS 100% 13.200 10.560 N LTN1 n/a
6 TRCN0000033805 CCGGGTTGTAACTTGTTCCTT pLKO.1 738 CDS 100% 3.000 2.400 N LTN1 n/a
7 TRCN0000289893 CCGGGTTGTAACTTGTTCCTT pLKO_005 738 CDS 100% 3.000 2.400 N LTN1 n/a
8 TRCN0000310281 TGCAACATGGGCAGCTATTTA pLKO_005 1424 CDS 100% 15.000 10.500 N LTN1 n/a
9 TRCN0000296365 GAACTGAGAGAGCTGATTTAC pLKO_005 5731 3UTR 100% 13.200 9.240 N LTN1 n/a
10 TRCN0000296366 GTAATGGCTACTTATACTATT pLKO_005 4933 CDS 100% 13.200 9.240 N LTN1 n/a
11 TRCN0000338508 TGTGAAACATTAACGTATATC pLKO_005 4069 CDS 100% 13.200 9.240 N LTN1 n/a
12 TRCN0000312545 GATCCCTGAAGTACATCAAAC pLKO_005 5351 3UTR 100% 10.800 7.560 N LTN1 n/a
13 TRCN0000033808 GCATTTCATCTGATGAAGTAA pLKO.1 3329 CDS 100% 5.625 3.938 N LTN1 n/a
14 TRCN0000033806 CCTGTAAATCTAATCAGTGAA pLKO.1 3928 CDS 100% 4.950 3.465 N LTN1 n/a
15 TRCN0000033807 GCCTGCTTGTACAAATGGTTT pLKO.1 5260 CDS 100% 4.950 3.465 N LTN1 n/a
16 TRCN0000033804 GCTGTGACAATGATATGGAAA pLKO.1 2144 CDS 100% 4.950 3.465 N LTN1 n/a
17 TRCN0000344638 TTAATGGCATGACGGTTAAAG pLKO_005 4892 CDS 100% 13.200 7.920 N LTN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320766.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14105 pDONR223 99.9% 99.1% 98.8% None (many diffs) n/a
2 ccsbBroad304_14105 pLX_304 0% 99.1% 98.8% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000476521 CGAACTTACCCTCTGGCAGTGGTC pLX_317 8.2% 99.1% 98.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV