Transcript: Human NM_001320778.2

Homo sapiens secretory carrier membrane protein 2 (SCAMP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SCAMP2 (10066)
Length:
2582
CDS:
111..1229

Additional Resources:

NCBI RefSeq record:
NM_001320778.2
NBCI Gene record:
SCAMP2 (10066)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370730 GTCTACACTGGATAATCATTC pLKO_005 992 CDS 100% 10.800 15.120 N SCAMP2 n/a
2 TRCN0000156233 CCTTTAGGTCCGACAACTCTT pLKO.1 865 CDS 100% 4.950 6.930 N SCAMP2 n/a
3 TRCN0000150604 GATATGCAAGATGCTCTACTA pLKO.1 680 CDS 100% 4.950 6.930 N SCAMP2 n/a
4 TRCN0000323384 GATATGCAAGATGCTCTACTA pLKO_005 680 CDS 100% 4.950 6.930 N SCAMP2 n/a
5 TRCN0000155523 GCAGAACACTGTAGCCAACTT pLKO.1 557 CDS 100% 4.950 6.930 N SCAMP2 n/a
6 TRCN0000323305 GCAGAACACTGTAGCCAACTT pLKO_005 557 CDS 100% 4.950 6.930 N SCAMP2 n/a
7 TRCN0000154550 GCGGATATGCAAGATGCTCTA pLKO.1 677 CDS 100% 4.050 5.670 N SCAMP2 n/a
8 TRCN0000377596 GCCCTGCTTCTATCAGGATTT pLKO_005 629 CDS 100% 10.800 7.560 N SCAMP2 n/a
9 TRCN0000323385 TTTCCGTGGGTGCCTTATGTG pLKO_005 1285 3UTR 100% 4.950 3.465 N SCAMP2 n/a
10 TRCN0000152907 GATGCTCTACTATCTGTGGAT pLKO.1 689 CDS 100% 2.640 1.848 N SCAMP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02302 pDONR223 100% 88.4% 88.4% None 224_352del n/a
2 ccsbBroad304_02302 pLX_304 0% 88.4% 88.4% V5 224_352del n/a
3 TRCN0000468503 TTAGGTAGAGGGGTCTGCACTTTG pLX_317 33.2% 88.4% 88.4% V5 224_352del n/a
Download CSV