Construct: ORF TRCN0000468503
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004030.1_s317c1
- Derived from:
- ccsbBroadEn_02302
- DNA Barcode:
- TTAGGTAGAGGGGTCTGCACTTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SCAMP2 (10066)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468503
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10066 | SCAMP2 | secretory carrier membrane ... | NM_005697.5 | 100% | 100% | |
| 2 | human | 10066 | SCAMP2 | secretory carrier membrane ... | NM_001320778.2 | 88.4% | 88.4% | 224_352del |
| 3 | human | 10066 | SCAMP2 | secretory carrier membrane ... | XM_017021856.1 | 81.8% | 79% | (many diffs) |
| 4 | mouse | 24044 | Scamp2 | secretory carrier membrane ... | NM_022813.3 | 86.7% | 88.7% | (many diffs) |
| 5 | mouse | 24044 | Scamp2 | secretory carrier membrane ... | XM_006511152.2 | 77% | 78.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1053
- ORF length:
- 987
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ggctttcgac accaacccct tcgcggaccc agtggatgta aaccccttcc 121 aggatccctc tgtgacccag ctgaccaacg ccccgcaggg cggcctggcg gaattcaacc 181 ccttctcaga gacaaatgca gcgacaacag ttcctgtcac ccaactccct gggtcctcac 241 agccagcggt tctccagcca tcagtggaac caacccagcc gaccccccag gccgtggtgt 301 ctgcagccca ggcaggcctg ctccggcagc aggaagaact ggacaggaaa gctgccgagc 361 tggaacgcaa ggagcgggag ctgcagaaca ctgtagccaa cttgcatgtg agacagaaca 421 actggccccc tctgccctcg tggtgccctg tgaagccctg cttctatcag gatttctcca 481 cagagatccc tgccgactac cagcggatat gcaagatgct ctactatctg tggatgttgc 541 attcagtgac tctgtttctg aacctgcttg cctgcctggc ctggttctcg ggcaacagct 601 ccaagggagt ggactttggc ctctccatcc tgtggtttct gatcttcact ccctgtgcct 661 tcctttgttg gtaccgaccc atctataagg cctttaggtc cgacaactct ttcagcttct 721 ttgtgttcTT CTTTGTATTT TTTTGTCAAA TAGGGATCTA CATCATCCAG TTGGTTGGCA 781 TCCCTGGCCT GGGGGACAGC GGTTGGATTG CAGCCCTGTC TACACTGGAT AATCATTCCC 841 TGGCCATATC AGTCATCATG ATGGTGGTGG CTGGCTTCTT CACCCTCTGT GCCGTGCTCT 901 CAGTCTTCCT CCTGCAGCGG GTGCACTCCC TCTACCGACG GACAGGGGCC AGCTTCCAGC 961 AGGCCCAGGA GGAGTTTTCC CAGGGCATCT TCAGCAGCAG AACCTTCCAC AGAGCTGCTT 1021 CATCTGCTGC CCAAGGAGCC TTCCAGGGGA ATTACCCAAC TTTCTTGTAC AAAGTGGTTG 1081 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1141 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATT 1201 AGGTAGAGGG GTCTGCACTT TGACGCGTTA AGTCgacaat caacctctgg attacaaaat 1261 ttgtgaaaga tt