Transcript: Human NM_001320819.1

Homo sapiens coenzyme Q10B (COQ10B), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
COQ10B (80219)
Length:
2284
CDS:
267..899

Additional Resources:

NCBI RefSeq record:
NM_001320819.1
NBCI Gene record:
COQ10B (80219)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430523 CACCTGTGTTGGAGCGATATA pLKO_005 571 CDS 100% 13.200 18.480 N COQ10B n/a
2 TRCN0000136405 CTAAGGAGATATGTGCACGAA pLKO.1 349 CDS 100% 2.640 3.696 N COQ10B n/a
3 TRCN0000424335 GCCGTATGGCTTAGGATATTT pLKO_005 1327 3UTR 100% 15.000 12.000 N COQ10B n/a
4 TRCN0000425920 CAATCATTTGGAGACTATTTG pLKO_005 656 CDS 100% 13.200 9.240 N COQ10B n/a
5 TRCN0000250999 TCAATCATTTGGAGACTATTT pLKO_005 655 CDS 100% 13.200 9.240 N Coq10b n/a
6 TRCN0000135717 GCAGAACTCTTCCACTACATA pLKO.1 316 CDS 100% 5.625 3.938 N COQ10B n/a
7 TRCN0000133671 GCATTTGTTAAACGCAGCTTT pLKO.1 990 3UTR 100% 4.950 3.465 N COQ10B n/a
8 TRCN0000135124 CTCTTCCACTACATACCTCAA pLKO.1 322 CDS 100% 4.050 2.835 N COQ10B n/a
9 TRCN0000133691 GAGCAGAAGTTGAAACTGTAA pLKO.1 1175 3UTR 100% 4.950 2.970 N COQ10B n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1396 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1396 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1396 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1398 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1398 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04192 pDONR223 100% 84.7% 86.1% None 0_1ins97;5G>C;7_19del n/a
2 ccsbBroad304_04192 pLX_304 0% 84.7% 86.1% V5 0_1ins97;5G>C;7_19del n/a
3 TRCN0000478429 ACCCAACCAGGGGATCCGATGCCT pLX_317 53.8% 84.7% 86.1% V5 0_1ins97;5G>C;7_19del n/a
Download CSV