Transcript: Human NM_001320916.1

Homo sapiens ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
ENTPD1 (953)
Length:
2171
CDS:
64..1512

Additional Resources:

NCBI RefSeq record:
NM_001320916.1
NBCI Gene record:
ENTPD1 (953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050291 CCCAGATAATGCTCTGCAATT pLKO.1 795 CDS 100% 10.800 15.120 N ENTPD1 n/a
2 TRCN0000257193 GCACCAAGAGACACCCGTTTA pLKO_005 459 CDS 100% 10.800 15.120 N ENTPD1 n/a
3 TRCN0000363195 CCTTCTGCAAGGCTATCATTT pLKO_005 1365 CDS 100% 13.200 9.240 N ENTPD1 n/a
4 TRCN0000219070 GACATTCAGGTTGCAAGTAAT pLKO_005 904 CDS 100% 13.200 9.240 N ENTPD1 n/a
5 TRCN0000230634 TGCTTTCATCCTGGATATAAG pLKO_005 943 CDS 100% 13.200 9.240 N ENTPD1 n/a
6 TRCN0000230633 GCCTATGGCTGGATTACTATC pLKO_005 625 CDS 100% 10.800 7.560 N ENTPD1 n/a
7 TRCN0000358681 TTGGCTTCTCCTCTATCATAG pLKO_005 161 CDS 100% 10.800 7.560 N ENTPD1 n/a
8 TRCN0000050289 GCAGTTTGAAATCCAGGGTAT pLKO.1 1035 CDS 100% 4.050 2.835 N ENTPD1 n/a
9 TRCN0000050292 TCCTCTATCATAGCTGTGATA pLKO.1 169 CDS 100% 0.495 0.347 N ENTPD1 n/a
10 TRCN0000050290 CGCTGGAGTAAAGGAGAAGTA pLKO.1 1302 CDS 100% 4.950 2.970 N ENTPD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488654 TTACAATCACTTAGGGAGTACATA pLX_317 23.7% 87.2% 83% V5 (many diffs) n/a
2 TRCN0000488171 TCATCTCCCGTACCTCATGACTTG pLX_317 20.5% 87% 83% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV