Transcript: Human NM_001320953.1

Homo sapiens zinc finger protein 232 (ZNF232), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ZNF232 (7775)
Length:
2164
CDS:
821..2074

Additional Resources:

NCBI RefSeq record:
NM_001320953.1
NBCI Gene record:
ZNF232 (7775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369739 GCTACTGACACCTCTACATTT pLKO_005 1487 CDS 100% 13.200 18.480 N ZNF232 n/a
2 TRCN0000021730 CCACTCTACCAGTCAAGAGAT pLKO.1 949 CDS 100% 4.950 6.930 N ZNF232 n/a
3 TRCN0000021731 CCACCCATTACTGAAGTGGAA pLKO.1 1442 CDS 100% 2.640 3.696 N ZNF232 n/a
4 TRCN0000364812 CAAAGAGTGAACAGGTATATT pLKO_005 1356 CDS 100% 15.000 10.500 N ZNF232 n/a
5 TRCN0000369669 ATGGTGCTCAGAGCTCATTAG pLKO_005 2014 CDS 100% 10.800 7.560 N ZNF232 n/a
6 TRCN0000376431 TAGGATGGCTGTATCACTAAC pLKO_005 817 5UTR 100% 10.800 7.560 N ZNF232 n/a
7 TRCN0000021729 GCCCAAGGACAAAGGATCATT pLKO.1 1414 CDS 100% 5.625 3.938 N ZNF232 n/a
8 TRCN0000021732 GCAGATGGTTGTCATCCATAA pLKO.1 1600 CDS 100% 10.800 6.480 N ZNF232 n/a
9 TRCN0000021733 GATGATGATGATGGGACCAAA pLKO.1 883 CDS 100% 4.950 2.970 N ZNF232 n/a
10 TRCN0000369741 GCCTTTAGTCAAAGCTCATAT pLKO_005 1922 CDS 100% 13.200 6.600 Y ZNF232 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11241 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11241 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479782 ATACTTCAAAAAGAAATTGAACCG pLX_317 28.7% 100% 100% V5 n/a
Download CSV