Transcript: Human NM_001321007.2

Homo sapiens tRNA aspartic acid methyltransferase 1 (TRDMT1), transcript variant g, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
TRDMT1 (1787)
Length:
13148
CDS:
482..1444

Additional Resources:

NCBI RefSeq record:
NM_001321007.2
NBCI Gene record:
TRDMT1 (1787)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234957 AGCGTTTATAACACCATTATT pLKO_005 2709 3UTR 100% 15.000 21.000 N TRDMT1 n/a
2 TRCN0000234955 ATACTTAAACTGCGATATTTC pLKO_005 1277 CDS 100% 13.200 18.480 N TRDMT1 n/a
3 TRCN0000234954 CAAATTCAAGGCTACGATATT pLKO_005 738 CDS 100% 13.200 18.480 N TRDMT1 n/a
4 TRCN0000234953 ATGTCAACACTGTCGCTAATG pLKO_005 139 5UTR 100% 10.800 15.120 N TRDMT1 n/a
5 TRCN0000035650 CGTGTGCTTTACCAAAGGATA pLKO.1 1138 CDS 100% 4.950 6.930 N TRDMT1 n/a
6 TRCN0000035651 GCGCTGAGAGAAAGCTGTATA pLKO.1 93 5UTR 100% 13.200 10.560 N TRDMT1 n/a
7 TRCN0000234956 ACGTGCATGTAGTAGCTAAAC pLKO_005 1401 CDS 100% 10.800 8.640 N TRDMT1 n/a
8 TRCN0000035653 CCAAAGTCATTGCTGCGATAT pLKO.1 1076 CDS 100% 10.800 7.560 N TRDMT1 n/a
9 TRCN0000035649 GCAGAAGAAATTCACAGGAAA pLKO.1 971 CDS 100% 4.950 3.465 N TRDMT1 n/a
10 TRCN0000072698 CAGATCATAAGGTCAGGAGAT pLKO.1 9081 3UTR 100% 4.050 2.430 N MRTO4 n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 9044 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 9044 3UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 12892 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 10148 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 10148 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 10148 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 12892 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06114 pDONR223 100% 81.6% 81.5% None 0_1ins213;88C>T;336G>T n/a
2 ccsbBroad304_06114 pLX_304 0% 81.6% 81.5% V5 0_1ins213;88C>T;336G>T n/a
3 TRCN0000477725 GCCCGCAAACCTTTGAGACGGGCG pLX_317 38% 81.6% 81.5% V5 0_1ins213;88C>T;336G>T n/a
Download CSV