Transcript: Human NM_001321036.2

Homo sapiens solute carrier family 30 member 4 (SLC30A4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SLC30A4 (7782)
Length:
1720
CDS:
264..827

Additional Resources:

NCBI RefSeq record:
NM_001321036.2
NBCI Gene record:
SLC30A4 (7782)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038374 CGGTTCAACAAACTTCGAGTT pLKO.1 387 CDS 100% 4.050 5.670 N SLC30A4 n/a
2 TRCN0000038377 CCTCAAATCTATGCTAAGGAA pLKO.1 290 CDS 100% 3.000 2.100 N SLC30A4 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1013 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1404 3UTR 100% 13.200 6.600 Y LIAS n/a
5 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1013 3UTR 100% 5.625 2.813 Y EID2B n/a
6 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1553 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01826 pDONR223 100% 43.1% 41.9% None (many diffs) n/a
2 ccsbBroad304_01826 pLX_304 0% 43.1% 41.9% V5 (many diffs) n/a
3 TRCN0000466033 TTATGATGGGTGCAAACGTCTTGT pLX_317 33.5% 43.1% 41.9% V5 (many diffs) n/a
Download CSV