Transcript: Human NM_001321207.2

Homo sapiens SUZ12 polycomb repressive complex 2 subunit (SUZ12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SUZ12 (23512)
Length:
4426
CDS:
241..2391

Additional Resources:

NCBI RefSeq record:
NM_001321207.2
NBCI Gene record:
SUZ12 (23512)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038728 GCTGACAATCAAATGAATCAT pLKO.1 2053 CDS 100% 5.625 3.938 N SUZ12 n/a
2 TRCN0000298921 GCTGACAATCAAATGAATCAT pLKO_005 2053 CDS 100% 5.625 3.938 N SUZ12 n/a
3 TRCN0000038725 GCTTACGTTTACTGGTTTCTT pLKO.1 645 CDS 100% 5.625 3.938 N SUZ12 n/a
4 TRCN0000298850 GCTTACGTTTACTGGTTTCTT pLKO_005 645 CDS 100% 5.625 3.938 N SUZ12 n/a
5 TRCN0000038726 CCAAACCTCTTGCCACTAGAA pLKO.1 1292 CDS 100% 4.950 3.465 N SUZ12 n/a
6 TRCN0000038724 CCACAAGAAATGGAAGTAGAT pLKO.1 1897 CDS 100% 4.950 3.465 N SUZ12 n/a
7 TRCN0000298920 CCACAAGAAATGGAAGTAGAT pLKO_005 1897 CDS 100% 4.950 3.465 N SUZ12 n/a
8 TRCN0000123890 CGAAACTTCATGCTTCATCTA pLKO.1 2131 CDS 100% 4.950 3.465 N Suz12 n/a
9 TRCN0000038727 CGGAATCTCATAGCACCAATA pLKO.1 547 CDS 100% 10.800 5.400 Y SUZ12 n/a
10 TRCN0000331118 CGGAATCTCATAGCACCAATA pLKO_005 547 CDS 100% 10.800 5.400 Y SUZ12 n/a
11 TRCN0000123891 CCAGTAATGAATTTGAACCTA pLKO.1 869 CDS 100% 3.000 1.500 Y Suz12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02784 pDONR223 100% 96.8% 96.8% None 384_385ins69 n/a
2 TRCN0000475819 ATTAACTTCATACCCCGTATCCTT pLX_317 14.7% 96.8% 96.8% V5 384_385ins69 n/a
Download CSV