Transcript: Human NM_001321369.2

Homo sapiens CD99 molecule (Xg blood group) (CD99), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CD99 (4267)
Length:
1078
CDS:
67..573

Additional Resources:

NCBI RefSeq record:
NM_001321369.2
NBCI Gene record:
CD99 (4267)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321369.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057504 CCATCTCTAGCTTCATTGCTT pLKO.1 440 CDS 100% 3.000 4.200 N CD99 n/a
2 TRCN0000291645 CCATCTCTAGCTTCATTGCTT pLKO_005 440 CDS 100% 3.000 4.200 N CD99 n/a
3 TRCN0000057506 GCGTTTCAGGTGGAGAAGGAA pLKO.1 311 CDS 100% 3.000 4.200 N CD99 n/a
4 TRCN0000291710 GCGTTTCAGGTGGAGAAGGAA pLKO_005 311 CDS 100% 3.000 4.200 N CD99 n/a
5 TRCN0000057503 CGGATGGTGGTTTCGATTTAT pLKO.1 131 CDS 100% 15.000 10.500 N CD99 n/a
6 TRCN0000291644 CGGATGGTGGTTTCGATTTAT pLKO_005 131 CDS 100% 15.000 10.500 N CD99 n/a
7 TRCN0000057507 AGCTTCATTGCTTACCAGAAA pLKO.1 448 CDS 100% 4.950 3.465 N CD99 n/a
8 TRCN0000057505 CCAGCTGTTCAGCGTACTCTT pLKO.1 541 CDS 100% 4.950 3.465 N CD99 n/a
9 TRCN0000291708 CCAGCTGTTCAGCGTACTCTT pLKO_005 541 CDS 100% 4.950 3.465 N CD99 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321369.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15499 pDONR223 0% 90.6% 90.8% None 87C>T;97_98ins48;426_427insGCA n/a
2 ccsbBroad304_15499 pLX_304 0% 90.6% 90.8% V5 87C>T;97_98ins48;426_427insGCA n/a
3 TRCN0000473568 CTTTACAAGAATATATTATAATTG pLX_317 75.6% 90.6% 90.8% V5 87C>T;97_98ins48;426_427insGCA n/a
Download CSV