Transcript: Human NM_001321397.2

Homo sapiens inhibitor of nuclear factor kappa B kinase regulatory subunit gamma (IKBKG), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
IKBKG (8517)
Length:
1970
CDS:
142..1398

Additional Resources:

NCBI RefSeq record:
NM_001321397.2
NBCI Gene record:
IKBKG (8517)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022144 CCAAGAATACGACAACCACAT pLKO.1 852 CDS 100% 4.050 5.670 N IKBKG n/a
2 TRCN0000236232 ACCACTTGCCTCGGGCTAATC pLKO_005 1654 3UTR 100% 3.600 5.040 N IKBKG n/a
3 TRCN0000236231 TGTCCCAAGTGCCAGTATCAG pLKO_005 1327 CDS 100% 4.950 3.960 N IKBKG n/a
4 TRCN0000236230 ATATGGACACCCTGCAGATAC pLKO_005 1355 CDS 100% 10.800 7.560 N IKBKG n/a
5 TRCN0000236229 CAAACAGGAGGTGATCGATAA pLKO_005 966 CDS 100% 10.800 7.560 N IKBKG n/a
6 TRCN0000236228 TGCAGCTGGAAGATCTCAAAC pLKO_005 911 CDS 100% 10.800 7.560 N IKBKG n/a
7 TRCN0000022148 GAGGGAGTACAGCAAACTGAA pLKO.1 1149 CDS 100% 4.950 3.465 N IKBKG n/a
8 TRCN0000022147 GAGAATCAAGAGCTCCGAGAT pLKO.1 310 CDS 100% 4.050 2.835 N IKBKG n/a
9 TRCN0000022145 GCTCGATCTGAAGAGGCAGAA pLKO.1 474 CDS 100% 4.050 2.835 N IKBKG n/a
10 TRCN0000022146 GCAGCACAAGATTGTGATGGA pLKO.1 1005 CDS 100% 2.640 1.848 N IKBKG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01945 pDONR223 100% 99.7% 99.7% None 393_394insCAG n/a
2 ccsbBroad304_01945 pLX_304 16.3% 99.7% 99.7% V5 393_394insCAG n/a
3 TRCN0000472009 CACGCCGCGCATTCCGTCTACAAC pLX_317 35% 99.7% 99.7% V5 393_394insCAG n/a
Download CSV