Transcript: Human NM_001321581.2

Homo sapiens calcium/calmodulin dependent protein kinase II delta (CAMK2D), transcript variant 22, mRNA.

Source:
NCBI, updated 2019-09-01
Taxon:
Homo sapiens (human)
Gene:
CAMK2D (817)
Length:
5730
CDS:
889..2250

Additional Resources:

NCBI RefSeq record:
NM_001321581.2
NBCI Gene record:
CAMK2D (817)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321581.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434219 GTTAATCATTGTCACCTAAAT pLKO_005 1141 CDS 100% 13.200 18.480 N CAMK2D n/a
2 TRCN0000195041 CCTGAAGCTTTGGGTAATTTA pLKO.1 1957 CDS 100% 15.000 10.500 N CAMK2D n/a
3 TRCN0000000475 TGTGGTGTCATTCTCTATATT pLKO.1 1369 CDS 100% 15.000 10.500 N CAMK2D n/a
4 TRCN0000422299 TGATCGAAGCTATCAACAATG pLKO_005 1883 CDS 100% 10.800 7.560 N CAMK2D n/a
5 TRCN0000195698 CCAAAGACAATGCAGTCAGAA pLKO.1 2143 CDS 100% 4.950 3.465 N CAMK2D n/a
6 TRCN0000195462 CCCTAATATTGTGCGACTTCA pLKO.1 981 CDS 100% 4.950 3.465 N CAMK2D n/a
7 TRCN0000000472 GCAATAAACCAATCCACACTA pLKO.1 2030 CDS 100% 4.950 3.465 N CAMK2D n/a
8 TRCN0000196967 GTCACCAACAGTACCCATCAA pLKO.1 2226 CDS 100% 4.950 3.465 N CAMK2D n/a
9 TRCN0000195619 CCATGGATCTGTCAACGTTCT pLKO.1 1579 CDS 100% 4.050 2.835 N CAMK2D n/a
10 TRCN0000000473 CTTACTATCAACCCTGCCAAA pLKO.1 1528 CDS 100% 4.050 2.835 N CAMK2D n/a
11 TRCN0000000471 CTTCTGCATTCTCTGTTCTCA pLKO.1 2266 3UTR 100% 3.000 2.100 N CAMK2D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321581.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14565 pDONR223 0% 87.7% 86.5% None (many diffs) n/a
2 ccsbBroad304_14565 pLX_304 0% 87.7% 86.5% V5 (many diffs) n/a
3 TRCN0000481152 TAATACCTAGCTTTCCAGTGCCAA pLX_317 31.4% 87.7% 86.5% V5 (many diffs) n/a
4 ccsbBroadEn_05930 pDONR223 100% 87.7% 86.5% None (many diffs) n/a
5 ccsbBroad304_05930 pLX_304 0% 87.7% 86.5% V5 (many diffs) n/a
6 TRCN0000481368 TGGGGGTCGACGCTCATAGTTAAT pLX_317 29.9% 87.7% 86.5% V5 (many diffs) n/a
Download CSV