Transcript: Human NM_001321721.2

Homo sapiens solute carrier family 28 member 1 (SLC28A1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-19
Taxon:
Homo sapiens (human)
Gene:
SLC28A1 (9154)
Length:
2041
CDS:
223..1854

Additional Resources:

NCBI RefSeq record:
NM_001321721.2
NBCI Gene record:
SLC28A1 (9154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437000 TGTTCGTCGCTCTCCTCTTTG pLKO_005 782 CDS 100% 10.800 7.560 N SLC28A1 n/a
2 TRCN0000043570 GATGCTCAGAACCTCATAGAA pLKO.1 1438 CDS 100% 5.625 3.938 N SLC28A1 n/a
3 TRCN0000043571 GCTGTGCTGGACTTTATCAAT pLKO.1 1531 CDS 100% 5.625 3.938 N SLC28A1 n/a
4 TRCN0000043569 CTCCTCGTCATCAGAACAGAA pLKO.1 877 CDS 100% 4.950 3.465 N SLC28A1 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1876 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1876 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491748 ATTATGCAAACGGGTAGTGATCTT pLX_317 14.6% 83% 81.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_07368 pDONR223 100% 82.9% 81.5% None (many diffs) n/a
3 ccsbBroad304_07368 pLX_304 0% 82.9% 81.5% V5 (many diffs) n/a
4 TRCN0000469767 GCTGGTTTTTTTGTTTTAACAGAT pLX_317 20.4% 82.9% 81.5% V5 (many diffs) n/a
5 TRCN0000488389 TAACTGTGGTCTTTGATTAAGTCC pLX_317 14.6% 82.9% 81.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV