Transcript: Human NM_001321822.2

Homo sapiens Cbl proto-oncogene B (CBLB), transcript variant 21, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
CBLB (868)
Length:
6799
CDS:
1671..3290

Additional Resources:

NCBI RefSeq record:
NM_001321822.2
NBCI Gene record:
CBLB (868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321822.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381172 ACCAAACCCGGAAGCTATATT pLKO_005 1123 5UTR 100% 15.000 21.000 N CBLB n/a
2 TRCN0000315183 CTACACCTCATGACCATATAA pLKO_005 1331 5UTR 100% 15.000 21.000 N CBLB n/a
3 TRCN0000007752 CGGGATGTGTTTGGGACTAAT pLKO.1 2127 CDS 100% 13.200 18.480 N CBLB n/a
4 TRCN0000007750 CCGGTTAAGTTGCACTCGATT pLKO.1 1146 5UTR 100% 4.950 6.930 N CBLB n/a
5 TRCN0000350496 CCGGTTAAGTTGCACTCGATT pLKO_005 1146 5UTR 100% 4.950 6.930 N CBLB n/a
6 TRCN0000007751 GCCCAGAATAATGTCGAAGTT pLKO.1 3207 CDS 100% 4.950 6.930 N CBLB n/a
7 TRCN0000315250 GCCCAGAATAATGTCGAAGTT pLKO_005 3207 CDS 100% 4.950 6.930 N CBLB n/a
8 TRCN0000039566 ATGCTATTCAGGATGCAGTT pLKO.1 371 5UTR 100% 0.000 0.000 N CBLB n/a
9 TRCN0000315252 ATATCAGCATTTACGACTTAT pLKO_005 534 5UTR 100% 13.200 10.560 N CBLB n/a
10 TRCN0000379559 CACCCTCCTCCCTAGCATAAA pLKO_005 2375 CDS 100% 13.200 9.240 N CBLB n/a
11 TRCN0000007749 CCACATCAACAGCTAAATCAT pLKO.1 3726 3UTR 100% 5.625 3.938 N CBLB n/a
12 TRCN0000315181 CCACATCAACAGCTAAATCAT pLKO_005 3726 3UTR 100% 5.625 3.938 N CBLB n/a
13 TRCN0000011198 CCCTTATTTCAAGCCCTGATT pLKO.1 1234 5UTR 100% 4.950 3.465 N CBLB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321822.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05939 pDONR223 100% 54.7% 54.7% None (many diffs) n/a
2 ccsbBroad304_05939 pLX_304 0% 54.7% 54.7% V5 (many diffs) n/a
3 TRCN0000465501 CTGAATGTTGTTTTAGAGTTACGA pLX_317 .6% 54.7% 54.7% V5 (many diffs) n/a
Download CSV