Transcript: Human NM_001321844.2

Homo sapiens COMM domain containing 4 (COMMD4), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
COMMD4 (54939)
Length:
977
CDS:
182..709

Additional Resources:

NCBI RefSeq record:
NM_001321844.2
NBCI Gene record:
COMMD4 (54939)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439235 CATGTCCCTCTCAGCAGACAA pLKO_005 628 CDS 100% 4.950 3.465 N COMMD4 n/a
2 TRCN0000420423 CCTGCTGCAATCCGTGGAAGA pLKO_005 544 CDS 100% 1.350 0.945 N COMMD4 n/a
3 TRCN0000438076 AGAAATCAGCACGCTGGCCAA pLKO_005 160 5UTR 100% 2.160 1.296 N COMMD4 n/a
4 TRCN0000444791 TGACGCCAAGTTTGAGTCAGG pLKO_005 277 CDS 100% 2.160 1.296 N COMMD4 n/a
5 TRCN0000142065 GCCTCACTTCTCTCTTGAGAA pLKO.1 848 3UTR 100% 0.495 0.297 N COMMD4 n/a
6 TRCN0000143372 GCTGTTATGAGGAGAAGCAAA pLKO.1 432 CDS 100% 4.950 2.475 Y COMMD4 n/a
7 TRCN0000142568 GTTTGAGTCAGGCGATGTGAA pLKO.1 286 CDS 100% 4.950 2.475 Y COMMD4 n/a
8 TRCN0000140987 CAGTGCTGAGTTTCATCCTCT pLKO.1 318 CDS 100% 2.640 1.320 Y COMMD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03489 pDONR223 100% 87.9% 87.9% None 0_1ins72 n/a
2 ccsbBroad304_03489 pLX_304 0% 87.9% 87.9% V5 0_1ins72 n/a
3 TRCN0000479852 TGGTAACCCCCCAGACACTCCAAT pLX_317 62% 87.9% 87.9% V5 0_1ins72 n/a
Download CSV