Transcript: Human NM_001321851.1

Homo sapiens thyroid hormone receptor interactor 11 (TRIP11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TRIP11 (9321)
Length:
9993
CDS:
375..6311

Additional Resources:

NCBI RefSeq record:
NM_001321851.1
NBCI Gene record:
TRIP11 (9321)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022022 CGGCAGCTGTACCTCTTATTA pLKO.1 6151 CDS 100% 15.000 21.000 N TRIP11 n/a
2 TRCN0000292343 CGGCAGCTGTACCTCTTATTA pLKO_005 6151 CDS 100% 15.000 21.000 N TRIP11 n/a
3 TRCN0000022019 GCAATCTACAAGTTACCGAAA pLKO.1 644 CDS 100% 4.050 5.670 N TRIP11 n/a
4 TRCN0000022023 CCACAGATTGTCTGATTCGAT pLKO.1 4481 CDS 100% 3.000 4.200 N TRIP11 n/a
5 TRCN0000292344 CCACAGATTGTCTGATTCGAT pLKO_005 4481 CDS 100% 3.000 4.200 N TRIP11 n/a
6 TRCN0000022021 GCAAAGGAACAAGAACTCAAT pLKO.1 1803 CDS 100% 4.950 3.465 N TRIP11 n/a
7 TRCN0000292297 GCAAAGGAACAAGAACTCAAT pLKO_005 1803 CDS 100% 4.950 3.465 N TRIP11 n/a
8 TRCN0000022020 GCACAAGTTCAGCACAGCATT pLKO.1 4236 CDS 100% 4.950 3.465 N TRIP11 n/a
9 TRCN0000292342 GCACAAGTTCAGCACAGCATT pLKO_005 4236 CDS 100% 4.950 3.465 N TRIP11 n/a
10 TRCN0000139012 CGCCTGTAATCCCAGAACTTT pLKO.1 8565 3UTR 100% 5.625 2.813 Y CCDC57 n/a
11 TRCN0000435634 TGACTATGAAGAACGAATTAA pLKO_005 1148 CDS 100% 15.000 10.500 N Ccdc39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11357 pDONR223 100% 3.8% 3.6% None (many diffs) n/a
2 ccsbBroad304_11357 pLX_304 0% 3.8% 3.6% V5 (many diffs) n/a
3 TRCN0000478616 ACGGCTAGGTAGTTGTCCCGGGTC pLX_317 100% 3.8% 3.6% V5 (many diffs) n/a
Download CSV