Transcript: Human NM_001321947.2

Homo sapiens fibroblast growth factor 14 (FGF14), transcript variant 19, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
FGF14 (2259)
Length:
12951
CDS:
322..924

Additional Resources:

NCBI RefSeq record:
NM_001321947.2
NBCI Gene record:
FGF14 (2259)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429078 GTATAGTGACCAGGTTATATT pLKO_005 389 CDS 100% 15.000 21.000 N FGF14 n/a
2 TRCN0000066991 ACCAGGTTATATTGCAGGCAA pLKO.1 397 CDS 100% 2.640 3.696 N Fgf14 n/a
3 TRCN0000058625 GCAAGGCTACTACTTGCAAAT pLKO.1 414 CDS 100% 1.080 1.512 N FGF14 n/a
4 TRCN0000436343 ATGGAATGCCCTACCAGATAT pLKO_005 1141 3UTR 100% 13.200 9.240 N FGF14 n/a
5 TRCN0000432310 TTTCTAGTTAGACGCTGTAAA pLKO_005 1338 3UTR 100% 13.200 9.240 N FGF14 n/a
6 TRCN0000416860 GGTTGTATATAGCCATGAATG pLKO_005 545 CDS 100% 10.800 7.560 N FGF14 n/a
7 TRCN0000058627 CCTGAATGCAAGTTTAAAGAA pLKO.1 601 CDS 100% 5.625 3.938 N FGF14 n/a
8 TRCN0000058624 CAGCACTAATTCTACACTCTT pLKO.1 471 CDS 100% 4.950 3.465 N FGF14 n/a
9 TRCN0000058626 GCCATTGGAAGTTGCCATGTA pLKO.1 777 CDS 100% 4.950 3.465 N FGF14 n/a
10 TRCN0000058623 GCAATAATGAATGGAGGCAAA pLKO.1 877 CDS 100% 4.050 2.835 N FGF14 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3191 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00560 pDONR223 100% 79.3% 79.3% None 0_1ins156 n/a
2 ccsbBroad304_00560 pLX_304 0% 79.3% 79.3% V5 0_1ins156 n/a
3 TRCN0000478594 TCCGATACATCGCTTTAATTTGAC pLX_317 47.7% 79.3% 79.3% V5 0_1ins156 n/a
Download CSV