Transcript: Human NM_001321970.2

Homo sapiens mitochondrial ribosomal protein S11 (MRPS11), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MRPS11 (64963)
Length:
3389
CDS:
11..592

Additional Resources:

NCBI RefSeq record:
NM_001321970.2
NBCI Gene record:
MRPS11 (64963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157810 CCAGGTAGTCTCTGCTAGTAA pLKO.1 298 CDS 100% 5.625 7.875 N MRPS11 n/a
2 TRCN0000275496 CCAGGTAGTCTCTGCTAGTAA pLKO_005 298 CDS 100% 5.625 7.875 N MRPS11 n/a
3 TRCN0000152979 GAAATTTGAGGAGATCCCAAT pLKO.1 241 CDS 100% 4.050 5.670 N MRPS11 n/a
4 TRCN0000275561 CGTGATCCACATCCGAGTTGT pLKO_005 436 CDS 100% 4.950 3.960 N MRPS11 n/a
5 TRCN0000156564 GTTCAGCATTTACCCTCCCAT pLKO.1 184 CDS 100% 2.640 2.112 N MRPS11 n/a
6 TRCN0000275499 GCTCCAGTGGGACCTTGTAAA pLKO_005 633 3UTR 100% 13.200 9.240 N MRPS11 n/a
7 TRCN0000155206 GAGATCCCAATTGCACACATT pLKO.1 251 CDS 100% 4.950 3.465 N MRPS11 n/a
8 TRCN0000275498 GAGATCCCAATTGCACACATT pLKO_005 251 CDS 100% 4.950 3.465 N MRPS11 n/a
9 TRCN0000156937 GCCTGGAAGTGATCTCAATCA pLKO.1 513 CDS 100% 4.950 3.465 N MRPS11 n/a
10 TRCN0000275497 GCCTGGAAGTGATCTCAATCA pLKO_005 513 CDS 100% 4.950 3.465 N MRPS11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12505 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12505 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471848 TTTCGGCTTCCCCGAACACATCAT pLX_317 87.3% 100% 100% V5 n/a
4 ccsbBroadEn_03990 pDONR223 100% 99.4% 99.4% None 64_65insGCA n/a
5 ccsbBroad304_03990 pLX_304 0% 99.4% 99.4% V5 64_65insGCA n/a
6 TRCN0000471484 ATCCAAATGCGCGCCAGTTGCCTA pLX_317 78.5% 99.4% 99.4% V5 64_65insGCA n/a
Download CSV